分離済み変異体

tm5083

Allele Nametm5083
BalanceNot Required
OutCrossNot Accepted
Sequence NameC44B11.3
Gene Namemec-12
Worm BaseAllele Name tm5083
Gene Name mec-12
Sequence C44B11.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3012/3013-3245/3246 (233 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(139..435, 2097..2531, 3137..3531, 5933..6155, 7538..7540))
Map position-7.88
Balancer
Map position of balancer
Sequence of primersExtFwd:TAAAGGCGCGAAGGGCGAAC,IntFwd:CTGAGTGAGCTGATTACAGT,ExtRev:ATAGCCTTACTCGTTGCGGA,IntRev:GTGCTAGAGAGTGTGGGGTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A.
Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons.
PLoS Genet 2023 19(8) e1010885 
[ PubMed ID = 37603562 ] [ RRC reference ]

Teoh JS, Vasudevan A, Wang W, Dhananjay S, Chandhok G, Pocock R, Koushika SP, Neumann B.
Synaptic branch stability is mediated by non-enzymatic functions of MEC-17/αTAT1 and ATAT-2.
Sci Rep 2022 12(1) 14003 
[ PubMed ID = 35977998 ] [ RRC reference ]

Miyasaka T, Shinzaki Y, Yoshimura S, Yoshina S, Kage-Nakadai E, Mitani S, Ihara Y.
Imbalanced Expression of Tau and Tubulin Induces Neuronal Dysfunction in C. elegans Models of Tauopathy.
Front Neurosci 2018 12 415 
[ PubMed ID = 29973863 ] [ RRC reference ]

Zheng C, Diaz-Cuadros M, Nguyen KCQ, Hall DH, Chalfie M.
Distinct effects of tubulin isotype mutations on neurite growth in Caenorhabditis elegans.
Mol Biol Cell 2017 28(21) 2786-2801 
[ PubMed ID = 28835377 ] [ RRC reference ]

Serrano-Saiz E, Oren-Suissa M, Bayer EA, Hobert O.
Sexually Dimorphic Differentiation of a C. elegans Hub Neuron Is Cell Autonomously Controlled by a Conserved Transcription Factor.
Curr Biol 2017 27(2) 199-209 
[ PubMed ID = 28065609 ] [ RRC reference ]

Chen CH, Lee A, Liao CP, Liu YW, Pan CL.
RHGF-1/PDZ-RhoGEF and retrograde DLK-1 signaling drive neuronal remodeling on microtubule disassembly.
Proc Natl Acad Sci U S A 2014 111(46) 16568-73 
[ PubMed ID = 25359212 ] [ RRC reference ]

Hsu JM, Chen CH, Chen YC, McDonald KL, Gurling M, Lee A, Garriga G, Pan CL.
Genetic analysis of a novel tubulin mutation that redirects synaptic vesicle targeting and causes neurite degeneration in C. elegans.
PLoS Genet 2014 10(11) e1004715 
[ PubMed ID = 25392990 ] [ RRC reference ]