Allele Name | tm5041 |
Allele Type | 通常株 |
Sequence Name | F39B2.7 |
Gene Name | F39B2.7 |
Worm Base | Allele Name |
tm5041
|
Gene Name |
F39B2.7
|
Sequence |
F39B2.7
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 19546/19547-TTTTTTTTTTTTT-20113/20114 (567 bp deletion + 13 bp insertion) |
Chromosome | I |
Putative gene structure | complement(join(15523..15685, 15732..16138, 17293..17575, 18626..18757, 19283..19550, 19750..19816)) |
Map position | 26.81 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:CCTCTGTCGATTTACCCTGA,ExtRev:CATCACTACAGTACCTCTGT,IntFwd:CCTCGTGAATTCTCCTCGCT,ExtFwd:CCCTGGTTTGAACCCCGATT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S. Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans. Sci Rep 2016 6 28198
[ PubMed ID = 27306325 ]
[ RRC reference ]
|
Navarro-González C, Moukadiri I, Villarroya M, López-Pascual E, Tuck S, Armengod ME. Mutations in the Caenorhabditis elegans orthologs of human genes required for mitochondrial tRNA modification cause similar electron transport chain defects but different nuclear responses. PLoS Genet 2017 13(7) e1006921
[ PubMed ID = 28732077 ]
[ RRC reference ]
|
|