分離済み変異体

tm504

Allele Nametm504
BalanceNot Required
OutCrossNot Accepted
Sequence NameF59G1.1
Gene Namecgt-3
Worm BaseAllele Name tm504
Gene Name cgt-3
Sequence F59G1.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19145/19146-ACGACACTGATTGCCATCGTTGGCTTCGTCTTCGTATTTTGCCTCTACCTTATTCAC-20195/20196 (1050 bp deletion + 57 bp insertion)
ChromosomeII
Putative gene structurejoin(18128..18158, 18956..19223, 19275..19510, 19565..19785, 19836..20159, 20203..20334, 20383..20706)
Map position-0.86
Balancer
Map position of balancer
Sequence of primersIntFwd:CTTGGCAGGTGTGAACATAG,IntRev:GTTGGAATTTTTCTGAACCTGA,ExtRev:GGTGATATAAATTACATAGTTGGA,ExtFwd:GACGCCTTTTCAGTGCAAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Arvin CL, Sibila Z, Lamendella R, Chan J, Staab T.
The impact of C. elegans ceramide glucosyltransferase enzymes on the beneficial effects of B. subtilis lifespan.
MicroPubl Biol 2023 2023  
[ PubMed ID = 37090153 ] [ RRC reference ]

Li N, Hua B, Chen Q, Teng F, Ruan M, Zhu M, Zhang L, Huo Y, Liu H, Zhuang M, Shen H, Zhu H.
A sphingolipid-mTORC1 nutrient-sensing pathway regulates animal development by an intestinal peroxisome relocation-based gut-brain crosstalk.
Cell Rep 2022 40(4) 111140 
[ PubMed ID = 35905721 ] [ RRC reference ]

Boland S, Schmidt U, Zagoriy V, Sampaio JL, Fritsche RF, Czerwonka R, Lübken T, Reimann J, Penkov S, Knölker HJ, Kurzchalia TV.
Phosphorylated glycosphingolipids essential for cholesterol mobilization in Caenorhabditis elegans.
Nat Chem Biol 2017 13(6) 647-654 
[ PubMed ID = 28369040 ] [ RRC reference ]

Hao L, Ben-David O, Babb SM, Futerman AH, Cohen BM, Buttner EA.
Clozapine Modulates Glucosylceramide, Clears Aggregated Proteins, and Enhances ATG8/LC3 in Caenorhabditis elegans.
Neuropsychopharmacology 2017 42(4) 951-962 
[ PubMed ID = 27711049 ] [ RRC reference ]

Cui M, Wang Y, Cavaleri J, Kelson T, Teng Y, Han M.
Starvation-Induced Stress Response Is Critically Impacted by Ceramide Levels in Caenorhabditis elegans.
Genetics 2017 205(2) 775-785 
[ PubMed ID = 27974500 ] [ RRC reference ]

Kniazeva M, Zhu H, Sewell AK, Han M.
A Lipid-TORC1 Pathway Promotes Neuronal Development and Foraging Behavior under Both Fed and Fasted Conditions in C. elegans.
Dev Cell 2015 33(3) 260-71 
[ PubMed ID = 25892013 ] [ RRC reference ]

Zhu H, Shen H, Sewell AK, Kniazeva M, Han M.
A novel sphingolipid-TORC1 pathway critically promotes postembryonic development in Caenorhabditis elegans.
Elife 2013 2 e00429 
[ PubMed ID = 23705068 ] [ RRC reference ]

Zhang H, Abraham N, Khan LA, Hall DH, Fleming JT, Göbel V.
Apicobasal domain identities of expanding tubular membranes depend on glycosphingolipid biosynthesis.
Nat Cell Biol 2011 13(10) 1189-201 
[ PubMed ID = 21926990 ] [ RRC reference ]

Nomura KH, Murata D, Hayashi Y, Dejima K, Mizuguchi S, Kage-Nakadai E, Gengyo-Ando K, Mitani S, Hirabayashi Y, Ito M, Nomura K.
Ceramide glucosyltransferase of the nematode Caenorhabditis elegans is involved in oocyte formation and in early embryonic cell division.
Glycobiology 2011 21(6) 834-48 
[ PubMed ID = 21325339 ] [ RRC reference ]

Marza E, Simonsen KT, Faergeman NJ, Lesa GM.
Expression of ceramide glucosyltransferases, which are essential for glycosphingolipid synthesis, is only required in a small subset of C. elegans cells.
J Cell Sci 2009 122(Pt 6) 822-33 
[ PubMed ID = 19240113 ] [ RRC reference ]