分離済み変異体

tm5030

Allele Nametm5030
BalanceNot Required
OutCrossNot Accepted
Sequence NameR13H8.1
Gene Namedaf-16
Worm BaseAllele Name tm5030
Gene Name daf-16
Sequence R13H8.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 6429/6430-6622/6623 (193 bp deletion)
ChromosomeI
Putative gene structureR13H8.1a=join(14814..15455, 16266..16427, 16590..16771, 16831..17050, 17300..17412, 18083..18356) daf-16f=join([H36N01] 3907..3930, 4169..4259, 4313..4463, [R13H8] 6960..7012, 7657..7802, 8516..8589, 16266..16427, 16590..16771, 16831..17050, 17300..17412, 18083..18356) daf-16b.=join(6409..6653, 6896..7012, 7663..7802, 8516..8589, 16266..16427, 16590..16771, 16831..17050, 17300..17412, 18083..18356)
Map position5.08
Balancer
Map position of balancer
Sequence of primersIntRev:CATTGCTCCCGTATAGGCTG,ExtRev:CCGAGCTGTCCACATTGCTC,IntFwd:ACCGTTCAAGCTGCTGCCTT,ExtFwd:AGCCGAAGCAATCAAGACCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ham S, Kim SS, Park S, Kwon HC, Ha SG, Bae Y, Lee GY, Lee SV.
Combinatorial transcriptomic and genetic dissection of insulin/IGF-1 signaling-regulated longevity in Caenorhabditis elegans.
Aging Cell 2024  e14151 
[ PubMed ID = 38529797 ] [ RRC reference ]

Kim Y, Nam S, Lim J, Jang M.
Autumn Olive (Elaeagnus umbellata Thunb.) Berries Improve Lipid Metabolism and Delay Aging in Middle-Aged Caenorhabditis elegans.
Int J Mol Sci 2024 25(6)  
[ PubMed ID = 38542392 ] [ RRC reference ]

Kim Y, Lee SB, Cho M, Choe S, Jang M.
Indian Almond (Terminalia catappa Linn.) Leaf Extract Extends Lifespan by Improving Lipid Metabolism and Antioxidant Activity Dependent on AMPK Signaling Pathway in Caenorhabditis elegans under High-Glucose-Diet Conditions.
Antioxidants (Basel) 2023 13(1)  
[ PubMed ID = 38275634 ] [ RRC reference ]

Cuko L, Cale AR, Rambo L, Knoblock ML, Karp X.
Distinct daf-16 isoforms regulate specification of vulval precursor cells in Caenorhabditis elegans.
MicroPubl Biol 2022 2022  
[ PubMed ID = 36575736 ] [ RRC reference ]

Wirick MJ, Cale AR, Smith IT, Alessi AF, Starostik MR, Cuko L, Lalk K, Schmidt MN, Olson BS, Salomon PM, Santos A, Schmitter-Sánchez A, Galagali H, Ranke KJ, Wolbert PA, Knoblock ML, Kim JK, Karp X.
daf-16/FOXO blocks adult cell fate in Caenorhabditis elegans dauer larvae via lin-41/TRIM71.
PLoS Genet 2021 17(11) e1009881 
[ PubMed ID = 34780472 ] [ RRC reference ]

Zhao Y, Zhang B, Marcu I, Athar F, Wang H, Galimov ER, Chapman H, Gems D.
Mutation of daf-2 extends lifespan via tissue-specific effectors that suppress distinct life-limiting pathologies.
Aging Cell 2021 20(3) e13324 
[ PubMed ID = 33609424 ] [ RRC reference ]

Nagashima T, Iino Y, Tomioka M.
DAF-16/FOXO promotes taste avoidance learning independently of axonal insulin-like signaling.
PLoS Genet 2019 15(7) e1008297 
[ PubMed ID = 31323047 ] [ RRC reference ]

Chen AT, Guo C, Itani OA, Budaitis BG, Williams TW, Hopkins CE, McEachin RC, Pande M, Grant AR, Yoshina S, Mitani S, Hu PJ.
Longevity Genes Revealed by Integrative Analysis of Isoform-Specific daf-16/FoxO Mutants of Caenorhabditis elegans.
Genetics 2015 201(2) 613-29 
[ PubMed ID = 26219299 ] [ RRC reference ]