分離済み変異体

tm5027

Allele Name

tm5027

Balance

Not Required

OutCross

Not Accepted

Sequence Name

Y48G1BL.2

Gene Name

atm-1

Worm Base

Allele Name

tm5027

Gene Name

atm-1

Sequence

Y48G1BL.2

Phenotype

homozygous viable.

Mutation site

2422/2423-2935/2936 (513 bp deletion)

Chromosome

Putative gene structure

join(36831..36923, 36974..37096, 37192..37676, 2901..3063, 3497..3815, 4409..4919, 5030..5151, 5434..5577, 5631..5710, 6544..6947, 7441..7786, 8562..8650, 8872..9067, 9209..9375, 9935..10185, 11057..11505, 11811..11925, 13899..14355, 15155..15545, 15976..16299, 299..590, 1494..1917, 2306..2450, 2532..2829, 3652..3823, 3925..4013, 4293..4543, 4936..5700)

Map position

-19.16

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CATCGGCGATACGTGAACAA,IntFwd:CCGACGGCATCCTTGGTTTG,ExtRev:GGCATACTCATGATCTCATG,IntRev:GCCCCGTAATATTCGACAAT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Nakayama A, Watanabe M, Yamashiro R, Kuroyanagi H, Matsuyama HJ, Oshima A, Mori I, Nakano S.
A hyperpolarizing neuron recruits undocked innexin hemichannels to transmit neural information in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(21) e2406565121
[ PubMed ID = 38753507 ] [ RRC reference ]

Furuta T, Arur S.
sart-3 functions to regulate germline sex determination in C. elegans .
MicroPubl Biol 2023 2023
[ PubMed ID = 37206989 ] [ RRC reference ]

Suehiro Y, Yoshina S, Motohashi T, Iwata S, Dejima K, Mitani S.
Efficient collection of a large number of mutations by mutagenesis of DNA damage response defective animals.
Sci Rep 2021 11(1) 7630
[ PubMed ID = 33828169 ] [ RRC reference ]

Ye FB, Hamza A, Singh T, Flibotte S, Hieter P, O'Neil NJ.
A Multimodal Genotoxic Anticancer Drug Characterized by Pharmacogenetic Analysis in Caenorhabditis elegans.
Genetics 2020 215(3) 609-621
[ PubMed ID = 32414869 ] [ RRC reference ]

Moriwaki T, Yamasaki A, Zhang-Akiyama QM.
ATM Induces Cell Death with Autophagy in Response to H₂O₂ Specifically in Caenorhabditis elegans Nondividing Cells.
Oxid Med Cell Longev 2018 2018 3862070
[ PubMed ID = 30057676 ] [ RRC reference ]

Moriwaki T, Kato Y, Nakamura C, Ishikawa S, Zhang-Akiyama QM.
A novel DNA damage response mediated by DNA mismatch repair in Caenorhabditis elegans: induction of programmed autophagic cell death in non-dividing cells.
Genes Cancer 2015 6(7-8) 341-55
[ PubMed ID = 26413217 ] [ RRC reference ]

Li X, O'Neil NJ, Moshgabadi N, Hieter P.
Synthetic cytotoxicity: digenic interactions with TEL1/ATM mutations reveal sensitivity to low doses of camptothecin.
Genetics 2014 197(2) 611-23
[ PubMed ID = 24653001 ] [ RRC reference ]

Jones MR, Huang JC, Chua SY, Baillie DL, Rose AM.
The atm-1 gene is required for genome stability in Caenorhabditis elegans.
Mol Genet Genomics 2012 287(4) 325-35
[ PubMed ID = 22350747 ] [ RRC reference ]