分離済み変異体

tm502

Allele Nametm502
BalanceNot Required
OutCrossNot Accepted
Sequence NameF12B6.1
Gene Nameabt-2
Worm BaseAllele Name tm502
Gene Name abt-2
Sequence F12B6.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. L. Timmons: negative for RNAi defects using various feeding strains to deliver dsRNA.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 24902/24903-TTTT-25400/25401 (498 bp deletion +4 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(16627..16803, 17527..18045, 18094..18244, 18990..19307, 19355..19511, 19559..19691, 19731..19994, 20845..21104, 21551..21888, 21934..22073, 22136..22259, 22826..22912, 22955..23324, 24711..24926, 24998..25137, 25188..25319, 25962..26044, 26143..26186, 26232..26550, 27379..27521, 27570..27756, 27804..27909, 28123..28358))
Map position-10.5
Balancer
Map position of balancer
Sequence of primersExtFwd:CAACGCAATGGAACGTGCCA,IntFwd:TCCGACCTTTGGGAGATGAA,IntRev:TTCTAGGCAGCCTTCCCAGT,ExtRev:GCTAACCCTCATTTTCACGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]

Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14 
[ PubMed ID = 18245353 ] [ RRC reference ]