分離済み変異体

tm501

Allele Nametm501
BalanceNot Required
OutCrossNot Accepted
Sequence NameC36B7.7
Gene Namehen-1
Worm BaseAllele Name tm501
Gene Name hen-1
Sequence C36B7.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. I. Katsura : Cell 109, 639-649 (2002). Dr. K. Shen: localization and accumulation of presynaptic veiscle clusters look wild type (evaluated presynaptic vesicle cluster in AIY using an integrated line expressing ttx3:Rab3:GFP). Dr. R. Shingai: normal chemotaxis to simultaneously presented Na-acetate and diacetyl.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31074/31075-31511/31512 (437 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(30974..31030, 31085..31166, 31211..31295, 31347..31404, 31465..31536))
Map position-1.85
Balancer
Map position of balancer
Sequence of primersExtFwd:ATAAGGTCGAGTGTAGCGTA,ExtRev:GAGGCGATGAACGACGTAGT,IntFwd:ATGGACCACATTCGCTGGTT,IntRev:TGTGATGACACAGTAGCCGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Boor SA, Meisel JD, Kim DH.
Neuroendocrine gene expression coupling of interoceptive bacterial food cues to foraging behavior of C. elegans.
Elife 2024 12  
[ PubMed ID = 38231572 ] [ RRC reference ]

Lindsay JH, Mathies LD, Davies AG, Bettinger JC.
A neuropeptide signal confers ethanol state dependency during olfactory learning in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2022 119(46) e2210462119 
[ PubMed ID = 36343256 ] [ RRC reference ]

Merritt DM, Melkis JG, Kwok B, Tran C, van der Kooy D.
Analysis of Mutants Suggests Kamin Blocking in C. elegans is Due to Interference with Memory Recall Rather than Storage.
Sci Rep 2019 9(1) 2371 
[ PubMed ID = 30787354 ] [ RRC reference ]

Kitazono T, Hara-Kuge S, Matsuda O, Inoue A, Fujiwara M, Ishihara T.
Multiple Signaling Pathways Coordinately Regulate Forgetting of Olfactory Adaptation through Control of Sensory Responses in Caenorhabditis elegans.
J Neurosci 2017 37(42) 10240-10251 
[ PubMed ID = 28924007 ] [ RRC reference ]

Ghosh R, Mohammadi A, Kruglyak L, Ryu WS.
Multiparameter behavioral profiling reveals distinct thermal response regimes in Caenorhabditis elegans.
BMC Biol 2012 10 85 
[ PubMed ID = 23114012 ] [ RRC reference ]

Nishio N, Mohri-Shiomi A, Nishida Y, Hiramatsu N, Kodama-Namba E, Kimura KD, Kuhara A, Mori I.
A novel and conserved protein AHO-3 is required for thermotactic plasticity associated with feeding states in Caenorhabditis elegans.
Genes Cells 2012 17(5) 365-86 
[ PubMed ID = 22512337 ] [ RRC reference ]

Li YX, Wang Y, Hu YO, Zhong JX, Wang DY.
Modulation of the assay system for the sensory integration of 2 sensory stimuli that inhibit each other in nematode Caenorhabditis elegans.
Neurosci Bull 2011 27(2) 69-82 
[ PubMed ID = 21441968 ] [ RRC reference ]

Shinkai Y, Yamamoto Y, Fujiwara M, Tabata T, Murayama T, Hirotsu T, Ikeda DD, Tsunozaki M, Iino Y, Bargmann CI, Katsura I, Ishihara T.
Behavioral choice between conflicting alternatives is regulated by a receptor guanylyl cyclase, GCY-28, and a receptor tyrosine kinase, SCD-2, in AIA interneurons of Caenorhabditis elegans.
J Neurosci 2011 31(8) 3007-15 
[ PubMed ID = 21414922 ] [ RRC reference ]

Kauffman AL, Ashraf JM, Corces-Zimmerman MR, Landis JN, Murphy CT.
Insulin signaling and dietary restriction differentially influence the decline of learning and memory with age.
PLoS Biol 2010 8(5) e1000372 
[ PubMed ID = 20502519 ] [ RRC reference ]

Reiner DJ, Ailion M, Thomas JH, Meyer BJ.
C. elegans anaplastic lymphoma kinase ortholog SCD-2 controls dauer formation by modulating TGF-beta signaling.
Curr Biol 2008 18(15) 1101-9 
[ PubMed ID = 18674914 ] [ RRC reference ]

Chi CA, Clark DA, Lee S, Biron D, Luo L, Gabel CV, Brown J, Sengupta P, Samuel AD.
Temperature and food mediate long-term thermotactic behavioral plasticity by association-independent mechanisms in C. elegans.
J Exp Biol 2007 210(Pt 22) 4043-52 
[ PubMed ID = 17981872 ] [ RRC reference ]

Torayama I, Ishihara T, Katsura I.
Caenorhabditis elegans integrates the signals of butanone and food to enhance chemotaxis to butanone.
J Neurosci 2007 27(4) 741-50 
[ PubMed ID = 17251413 ] [ RRC reference ]

Kodama E, Kuhara A, Mohri-Shiomi A, Kimura KD, Okumura M, Tomioka M, Iino Y, Mori I.
Insulin-like signaling and the neural circuit for integrative behavior in C. elegans.
Genes Dev 2006 20(21) 2955-60 
[ PubMed ID = 17079685 ] [ RRC reference ]

Kuhara A, Mori I.
Molecular physiology of the neural circuit for calcineurin-dependent associative learning in Caenorhabditis elegans.
J Neurosci 2006 26(37) 9355-64 
[ PubMed ID = 16971519 ] [ RRC reference ]

Tomioka M, Adachi T, Suzuki H, Kunitomo H, Schafer WR, Iino Y.
The insulin/PI 3-kinase pathway regulates salt chemotaxis learning in Caenorhabditis elegans.
Neuron 2006 51(5) 613-25 
[ PubMed ID = 16950159 ] [ RRC reference ]

Labbé JC, Pacquelet A, Marty T, Gotta M.
A genomewide screen for suppressors of par-2 uncovers potential regulators of PAR protein-dependent cell polarity in Caenorhabditis elegans.
Genetics 2006 174(1) 285-95 
[ PubMed ID = 16816419 ] [ RRC reference ]

Shtonda BB, Avery L.
Dietary choice behavior in Caenorhabditis elegans.
J Exp Biol 2006 209(Pt 1) 89-102 
[ PubMed ID = 16354781 ] [ RRC reference ]

Ishihara T, Iino Y, Mohri A, Mori I, Gengyo-Ando K, Mitani S, Katsura I.
HEN-1, a secretory protein with an LDL receptor motif, regulates sensory integration and learning in Caenorhabditis elegans.
Cell 2002 109(5) 639-49 
[ PubMed ID = 12062106 ] [ RRC reference ]