| Allele Name | tm5004 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | T23G4.3 |
| Gene Name | nyn-1 |
| Worm Base | Allele Name |
tm5004
|
| Gene Name |
nyn-1
|
| Sequence |
T23G4.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 14856/14857-15626/15627 (770 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement(join(13395..13637, 13824..14072, 14118..14249, 14312..14514, 14576..15206)) |
| Map position | 10.57 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CGCGAGACCAGAAACAACGT,ExtRev:CGCCCAGGATGTTGATAATC,IntFwd:TGACTTTGTGGCCACGAATC,IntRev:TAGGCTTGCCGGCAAGCTTG |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Lowe DD, Newman M, Ruvkun G, Kennedy SG. The microRNA miR-243 directs poly(UG) modification of a somatic mRNA in C. elegans. MicroPubl Biol 2025 2025
[ PubMed ID = 40880989 ]
[ RRC reference ]
|
Uebel CJ, Anderson DC, Mandarino LM, Manage KI, Aynaszyan S, Phillips CM. Distinct regions of the intrinsically disordered protein MUT-16 mediate assembly of a small RNA amplification complex and promote phase separation of Mutator foci. PLoS Genet 2018 14(7) e1007542
[ PubMed ID = 30036386 ]
[ RRC reference ]
|
Tsai HY, Chen CC, Conte D Jr, Moresco JJ, Chaves DA, Mitani S, Yates JR 3rd, Tsai MD, Mello CC. A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi. Cell 2015 160(3) 407-19
[ PubMed ID = 25635455 ]
[ RRC reference ]
|
|