Allele Name | tm5002 |
Allele Type | 通常株 |
Sequence Name | T24F1.3 |
Gene Name | T24F1.3 |
Worm Base | Allele Name |
tm5002
|
Gene Name |
T24F1.3
|
Sequence |
T24F1.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 8482/8483-CTAG-8790/8791 (308 bp deletion + 4 bp insertion) |
Chromosome | II |
Putative gene structure | join(5126..5165, 6148..6235, 7676..7769, 7849..7983, 8279..8510, 8768..9562, 9849..9964, 10007..10110, 10191..10287, 10367..10513) |
Map position | 3.41 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:GCCTTTAAAATTAGGCCCTC,IntFwd:ATCTGGGATTTCGGCGCCAC,ExtRev:TCAGTAATCTGTTCGCACTC,IntRev:GGGTTATCGGCAACTCGGAA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Takenaka M, Inoue H, Takeshima A, Kakura T, Hori T. C. elegans Rassf homolog, rasf-1, is functionally associated with rab-39 Rab GTPase in oxidative stress response. Genes Cells 2013 18(3) 203-10
[ PubMed ID = 23294242 ]
[ RRC reference ]
|
Iwasa H, Kuroyanagi H, Maimaiti S, Ikeda M, Nakagawa K, Hata Y. Characterization of RSF-1, the Caenorhabditis elegans homolog of the Ras-association domain family protein 1. Exp Cell Res 2013 319(3) 1-11
[ PubMed ID = 23103556 ]
[ RRC reference ]
|
|