分離済み変異体

tm4995

Allele Nametm4995
BalanceNot Required
OutCrossNot Accepted
Sequence NameC02F12.1
Gene Nametsp-17
Worm BaseAllele Name tm4995
Gene Name tsp-17
Sequence C02F12.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19672/19673-ATGGCAACAGAACGTG-19971/19972 (299 bp deletion + 16 bp insertion)
ChromosomeX
Putative gene structurejoin(19801..19869, 20217..20321, 20367..20441, 21256..21369, 21414..21623, 22146..22229, 22415..22489)
Map position-9.79
Balancer
Map position of balancer
Sequence of primersIntRev:TGAGGAACAACGTTTGCGCT,ExtRev:CGATCTCGTGAGTAACGGTT,IntFwd:CAGGCAGTGCATGGCAACAG,ExtFwd:CTCTGGGACAGTTAGATGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Offenburger SL, Gartner A.
6-hydroxydopamine (6-OHDA) Oxidative Stress Assay for Observing Dopaminergic Neuron Loss in Caenorhabditis elegans.
Bio Protoc 2018 8(18)  
[ PubMed ID = 30406156 ] [ RRC reference ]

Offenburger SL, Jongsma E, Gartner A.
Mutations in Caenorhabditis elegans neuroligin-like glit-1, the apoptosis pathway and the calcium chaperone crt-1 increase dopaminergic neurodegeneration after 6-OHDA treatment.
PLoS Genet 2018 14(1) e1007106 
[ PubMed ID = 29346364 ] [ RRC reference ]

Masoudi N, Ibanez-Cruceyra P, Offenburger SL, Holmes A, Gartner A.
Tetraspanin (TSP-17) protects dopaminergic neurons against 6-OHDA-induced neurodegeneration in C. elegans.
PLoS Genet 2014 10(12) e1004767 
[ PubMed ID = 25474638 ] [ RRC reference ]

Broekhuis JR, Rademakers S, Burghoorn J, Jansen G.
SQL-1, homologue of the Golgi protein GMAP210, modulates intraflagellar transport in C. elegans.
J Cell Sci 2013 126(Pt 8) 1785-95 
[ PubMed ID = 23444385 ] [ RRC reference ]