分離済み変異体

tm4993

Allele Nametm4993
BalanceNot Required
OutCrossNot Accepted
Sequence NameW02B12.15
Gene Namecisd-1
Worm BaseAllele Name tm4993
Gene Name cisd-1
Sequence W02B12.15
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 23969/23970-24285/24286 (316 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(23652..24054, 24110..24198))
Map position3.49
Balancer
Map position of balancer
Sequence of primersExtRev:AACGCCACAGCATTGTTCTG,IntRev:AAGGTTACGTATCTGGTCTC,ExtFwd:AAGCGCCGCCGTGAAAGAAT,IntFwd:TCCTAACTCGAGTCGCCGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hsiung KC, Tang HY, Cheng ML, Hung LM, Chin-Ming Tan B, Lo SJ.
Mitochondrial Bioenergetics Deficiency in cisd-1 Mutants is Linked to AMPK-Mediated Lipid Metabolism.
Biomed J 2024  100806 
[ PubMed ID = 39521176 ] [ RRC reference ]

Ploumi C, Kyriakakis E, Tavernarakis N.
Coupling of autophagy and the mitochondrial intrinsic apoptosis pathway modulates proteostasis and ageing in Caenorhabditis elegans.
Cell Death Dis 2023 14(2) 110 
[ PubMed ID = 36774344 ] [ RRC reference ]

King SD, Gray CF, Song L, Mittler R, Padilla PA.
The mitochondrial localized CISD-3.1/CISD-3.2 proteins are required to maintain normal germline structure and function in Caenorhabditis elegans.
PLoS One 2021 16(2) e0245174 
[ PubMed ID = 33544710 ] [ RRC reference ]

Hsiung KC, Liu KY, Tsai TF, Yoshina S, Mitani S, Chin-Ming Tan B, Lo SJ.
Defects in CISD-1, a mitochondrial iron-sulfur protein, lower glucose level and ATP production in Caenorhabditis elegans.
Biomed J 2020 43(1) 32-43 
[ PubMed ID = 32200954 ] [ RRC reference ]

King SD, Gray CF, Song L, Nechushtai R, Gumienny TL, Mittler R, Padilla PA.
The cisd gene family regulates physiological germline apoptosis through ced-13 and the canonical cell death pathway in Caenorhabditis elegans.
Cell Death Differ 2019 26(1) 162-178 
[ PubMed ID = 29666474 ] [ RRC reference ]