分離済み変異体

tm494

Allele Nametm494
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0336.6
Gene Nameabi-1
Worm BaseAllele Name tm494
Gene Name abi-1
Sequence B0336.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable: Dr. M. Barr: mating behavior=WT, mating efficiency=WT, Dyf+, PKD-2::GFP localization=WT, Dr. E. Stringham: Development 136, 563 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3365/3366-4049/4050 (684 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(3206..3366, 3851..4442, 4934..5375, 5422..5507, 5581..5610))
Map position-1.45
Balancer
Map position of balancer
Sequence of primersExtFwd:CTTCTCACTGCTGCAAACGA,IntFwd:GGGACCACTGCTTCCTTCAT,ExtRev:CAAACCTCTGCTGCAGCTTT,IntRev:CAGACCGGCAATTTGTGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Chen H, Li H, Wang D.
Graphene Oxide Dysregulates Neuroligin/NLG-1-Mediated Molecular Signaling in Interneurons in Caenorhabditis elegans.
Sci Rep 2017 7 41655 
[ PubMed ID = 28128356 ] [ RRC reference ]

Fancsalszky L, Monostori E, Farkas Z, Pourkarimi E, Masoudi N, Hargitai B, Bosnar MH, Deželjin M, Zsákai A, Vellai T, Mehta A, Takács-Vellai K.
NDK-1, the homolog of NM23-H1/H2 regulates cell migration and apoptotic engulfment in C. elegans.
PLoS One 2014 9(3) e92687 
[ PubMed ID = 24658123 ] [ RRC reference ]

Judy ME, Nakamura A, Huang A, Grant H, McCurdy H, Weiberth KF, Gao F, Coppola G, Kenyon C, Kao AW.
A shift to organismal stress resistance in programmed cell death mutants.
PLoS Genet 2013 9(9) e1003714 
[ PubMed ID = 24068943 ] [ RRC reference ]

McShea MA, Schmidt KL, Dubuke ML, Baldiga CE, Sullender ME, Reis AL, Zhang S, O'Toole SM, Jeffers MC, Warden RM, Kenney AH, Gosselin J, Kuhlwein M, Hashmi SK, Stringham EG, Ryder EF.
Abelson interactor-1 (ABI-1) interacts with MRL adaptor protein MIG-10 and is required in guided cell migrations and process outgrowth in C. elegans.
Dev Biol 2013 373(1) 1-13 
[ PubMed ID = 23022657 ] [ RRC reference ]

Stavoe AK, Nelson JC, Martínez-Velázquez LA, Klein M, Samuel AD, Colón-Ramos DA.
Synaptic vesicle clustering requires a distinct MIG-10/Lamellipodin isoform and ABI-1 downstream from Netrin.
Genes Dev 2012 26(19) 2206-21 
[ PubMed ID = 23028145 ] [ RRC reference ]

Xu Y, Quinn CC.
MIG-10 functions with ABI-1 to mediate the UNC-6 and SLT-1 axon guidance signaling pathways.
PLoS Genet 2012 8(11) e1003054 
[ PubMed ID = 23209429 ] [ RRC reference ]

Anderson C, Zhou S, Sawin E, Horvitz HR, Hurwitz ME.
SLI-1 Cbl inhibits the engulfment of apoptotic cells in C. elegans through a ligase-independent function.
PLoS Genet 2012 8(12) e1003115 
[ PubMed ID = 23271977 ] [ RRC reference ]

Van Epps H, Dai Y, Qi Y, Goncharov A, Jin Y.
Nuclear pre-mRNA 3'-end processing regulates synapse and axon development in C. elegans.
Development 2010 137(13) 2237-50 
[ PubMed ID = 20530551 ] [ RRC reference ]

Hurwitz ME, Vanderzalm PJ, Bloom L, Goldman J, Garriga G, Horvitz HR.
Abl kinase inhibits the engulfment of apoptotic [corrected] cells in Caenorhabditis elegans.
PLoS Biol 2009 7(4) e99 
[ PubMed ID = 19402756 ] [ RRC reference ]

Schmidt KL, Marcus-Gueret N, Adeleye A, Webber J, Baillie D, Stringham EG.
The cell migration molecule UNC-53/NAV2 is linked to the ARP2/3 complex by ABI-1.
Development 2009 136(4) 563-74 
[ PubMed ID = 19168673 ] [ RRC reference ]

Patel FB, Bernadskaya YY, Chen E, Jobanputra A, Pooladi Z, Freeman KL, Gally C, Mohler WA, Soto MC.
The WAVE/SCAR complex promotes polarized cell movements and actin enrichment in epithelia during C. elegans embryogenesis.
Dev Biol 2008 324(2) 297-309 
[ PubMed ID = 18938151 ] [ RRC reference ]