分離済み変異体

tm4919

Allele Nametm4919
BalanceNot Required
OutCrossNot Accepted
Sequence NameZC376.7
Gene Nameatfs-1
Worm BaseAllele Name tm4919 (x1)
Gene Name atfs-1
Sequence ZC376.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Homozygotes tend to be sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 25513/25514-25847/25848 (334 bp deletion)
ChromosomeV
Putative gene structurejoin(25621..25716, 25771..25841, 25891..26266, 27353..27424, 27477..27557, 27691..28343, 28442..28559)
Map position6.2
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntRev:TCCCGTACCATATTATCTCC,ExtFwd:CACTGCCAATGTGAGTCATG,ExtRev:GTCGGCAATGCGAAAAAGAT,IntFwd:ATCCCCATAATGGTTCGCTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Li Y, Wang C, Fu X, Wu D, He C, Dai W, Yue X, Luo Z, Yang J, Wan QL.
Transgenerational inheritance of mitochondrial hormetic oxidative stress mediated by histone H3K4me3 and H3K27me3 modifications.
Redox Biol 2025 82 103598 
[ PubMed ID = 40112613 ] [ RRC reference ]

Cao W, Fan Q, Amparado G, Begic D, Godini R, Gopal S, Pocock R.
A nucleic acid binding protein map of germline regulation in Caenorhabditis elegans.
Nat Commun 2024 15(1) 6884 
[ PubMed ID = 39128930 ] [ RRC reference ]

Dai CY, Ng CC, Hung GCC, Kirmes I, Hughes LA, Du Y, Brosnan CA, Ahier A, Hahn A, Haynes CM, Rackham O, Filipovska A, Zuryn S.
ATFS-1 counteracts mitochondrial DNA damage by promoting repair over transcription.
Nat Cell Biol 2023 25(8) 1111-1120 
[ PubMed ID = 37460695 ] [ RRC reference ]

Sun CL, Van Gilst M, Crowder CM.
Hypoxia-induced mitochondrial stress granules.
Cell Death Dis 2023 14(7) 448 
[ PubMed ID = 37468471 ] [ RRC reference ]

Liao CP, Chiang YC, Tam WH, Chen YJ, Chou SH, Pan CL.
Neurophysiological basis of stress-induced aversive memory in the nematode Caenorhabditis elegans.
Curr Biol 2022 32(24) 5309-5322.e6 
[ PubMed ID = 36455561 ] [ RRC reference ]

Soo SK, Traa A, Rudich PD, Mistry M, Van Raamsdonk JM.
Activation of mitochondrial unfolded protein response protects against multiple exogenous stressors.
Life Sci Alliance 2021 4(12)  
[ PubMed ID = 34583931 ] [ RRC reference ]

Yan J, Sun CL, Shin S, Van Gilst M, Crowder CM.
Effect of the mitochondrial unfolded protein response on hypoxic death and mitochondrial protein aggregation.
Cell Death Dis 2021 12(7) 711 
[ PubMed ID = 34267182 ] [ RRC reference ]

Deng P, Uma Naresh N, Du Y, Lamech LT, Yu J, Zhu LJ, Pukkila-Worley R, Haynes CM.
Mitochondrial UPR repression during Pseudomonas aeruginosa infection requires the bZIP protein ZIP-3.
Proc Natl Acad Sci U S A 2019 116(13) 6146-6151 
[ PubMed ID = 30850535 ] [ RRC reference ]

Oks O, Lewin S, Goncalves IL, Sapir A.
The UPRmt Protects Caenorhabditis elegans from Mitochondrial Dysfunction by Upregulating Specific Enzymes of the Mevalonate Pathway.
Genetics 2018 209(2) 457-473 
[ PubMed ID = 29599115 ] [ RRC reference ]

Haroon S, Li A, Weinert JL, Fritsch C, Ericson NG, Alexander-Floyd J, Braeckman BP, Haynes CM, Bielas JH, Gidalevitz T, Vermulst M.
Multiple Molecular Mechanisms Rescue mtDNA Disease in C. elegans.
Cell Rep 2018 22(12) 3115-3125 
[ PubMed ID = 29562168 ] [ RRC reference ]

Kaufman DM, Wu X, Scott BA, Itani OA, Van Gilst MR, Bruce JE, Crowder CM.
Ageing and hypoxia cause protein aggregation in mitochondria.
Cell Death Differ 2017 24(10) 1730-1738 
[ PubMed ID = 28644434 ] [ RRC reference ]

Lin YF, Schulz AM, Pellegrino MW, Lu Y, Shaham S, Haynes CM.
Maintenance and propagation of a deleterious mitochondrial genome by the mitochondrial unfolded protein response.
Nature 2016 533(7603) 416-9 
[ PubMed ID = 27135930 ] [ RRC reference ]

Kaufman DM, Crowder CM.
Mitochondrial Proteostatic Collapse Leads to Hypoxic Injury.
Curr Biol 2015 25(16) 2171-6 
[ PubMed ID = 26234215 ] [ RRC reference ]

Pellegrino MW, Nargund AM, Kirienko NV, Gillis R, Fiorese CJ, Haynes CM.
Mitochondrial UPR-regulated innate immunity provides resistance to pathogen infection.
Nature 2014 516(7531) 414-7 
[ PubMed ID = 25274306 ] [ RRC reference ]