分離済み変異体

tm4910

Allele Nametm4910
BalanceNot Required
OutCrossNot Accepted
Sequence NameD1044.8
Gene Namenekl-4
Worm BaseAllele Name tm4910
Gene Name nekl-4
Sequence D1044.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 8685/8686-TCA-9205/9206 (520 bp deletion + 3 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(6677..6759, 6805..7311, 7526..7930, 8077..8308, 8450..8887, 9003..9597, 9971..10017, 10064..10188, 10235..10494, 10653..10736, 10976..11079))
Map position-1.58
Balancer
Map position of balancer
Sequence of primersIntFwd:TTGGGCACATGAGCCCCACA,ExtFwd:CAACGCTACCAATACACTAG,IntRev:GCATACCGAACAACTAGCCA,ExtRev:TAACAAGTGACCGGCACCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Turan MG, Kantarci H, Cevik S, Kaplan OI.
ARL13B regulates juxtaposed cilia-cilia elongation in BBSome dependent manner in Caenorhabditis elegans.
iScience 2025 28(2) 111791 
[ PubMed ID = 39925426 ] [ RRC reference ]

Power KM, Nguyen KC, Silva A, Singh S, Hall DH, Rongo C, Barr MM.
NEKL-4 regulates microtubule stability and mitochondrial health in C. elegans ciliated neurons.
bioRxiv 2024   
[ PubMed ID = 38405845 ] [ RRC reference ]

Power KM, Barr MM.
osm-5p- driven fluorophores are differentially expressed in ccpp-1Δ and nekl-4Δ mutant ciliated neurons.
MicroPubl Biol 2024 2024  
[ PubMed ID = 39135985 ] [ RRC reference ]

Park K, Li C, Tsiropoulou S, Gonçalves J, Kondratev C, Pelletier L, Blacque OE, Leroux MR.
CDKL kinase regulates the length of the ciliary proximal segment.
Curr Biol 2021 31(11) 2359-2373.e7 
[ PubMed ID = 33857430 ] [ RRC reference ]

Power KM, Akella JS, Gu A, Walsh JD, Bellotti S, Morash M, Zhang W, Ramadan YH, Ross N, Golden A, Smith HE, Barr MM, O'Hagan R.
Mutation of NEKL-4/NEK10 and TTLL genes suppress neuronal ciliary degeneration caused by loss of CCPP-1 deglutamylase function.
PLoS Genet 2020 16(10) e1009052 
[ PubMed ID = 33064774 ] [ RRC reference ]