| Allele Name | tm491 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | B0414.2 |
| Gene Name | rnt-1 |
| Worm Base | Allele Name |
tm491
|
| Gene Name |
rnt-1
|
| Sequence |
B0414.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. J. Lee: short body length. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 14468/14469-15314/15315 (846 bp deletion) |
| Chromosome | I |
| Putative gene structure | join (13159..13173, 13218..13335, 13592..13711, 14513..14586, 15563..15679, 16289..16347, 16400..16518, 16571..16800) |
| Map position | 0.45 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GCAAAAGTGCATCGACAAGT,IntRev:CAGGCGTTCGGATAATATCA,IntFwd:TTTGCGGTTTGTCGGGCGGT,ExtRev:CAAAAAATCGTACCGGTGGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Lee K, Shim J, Lee J, Lee J.
Identification of genes interacting with rnt-1 through large-scale RNAi screening in Caenorhabditis elegans.
G3 (Bethesda) 2013 3(10) 1779-84
[ PubMed ID = 23979934 ]
[ RRC reference ]
|
Lee K, Shim J, Bae J, Kim YJ, Lee J.
Stabilization of RNT-1 protein, runt-related transcription factor (RUNX) protein homolog of Caenorhabditis elegans, by oxidative stress through mitogen-activated protein kinase pathway.
J Biol Chem 2012 287(13) 10444-10452
[ PubMed ID = 22308034 ]
[ RRC reference ]
|
Shim J, Lee J.
Regulation of rnt-1 expression mediated by the opposing effects of BRO-1 and DBL-1 in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2008 367(1) 130-6
[ PubMed ID = 18158917 ]
[ RRC reference ]
|
Kagoshima H, Sawa H, Mitani S, Bürglin TR, Shigesada K, Kohara Y.
The C. elegans RUNX transcription factor RNT-1/MAB-2 is required for asymmetrical cell division of the T blast cell.
Dev Biol 2005 287(2) 262-73
[ PubMed ID = 16226243 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.