| Allele Name | tm4867 |
| Allele Type | 通常株 |
| Sequence Name | C15H11.2 |
| Gene Name | gnrr-2 |
| Worm Base | Allele Name |
tm4867
|
| Gene Name |
gnrr-2
|
| Sequence |
C15H11.2
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 26473/26474-26950/26951 (477 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(24567..24806, 25200..25315, 25780..25939, 26497..26673, 26724..26844, 26893..27130, 27297..27384) |
| Map position | 6.29 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:ATGGGCAAAACGCCCGTTAA,IntFwd:GTACCGTATATTTGGGTCCA,ExtRev:GAATCGAATCCCCTGGCATC,IntRev:GCCCTGTCATCATTATCCCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Ma L, Kuhn J, Chang YT, Elnatan D, Luxton GWG, Starr DA.
FLN-2 functions in parallel to LINC complexes and Cdc42/actin pathways during P-cell nuclear migration through constricted spaces in Caenorhabditis elegans.
bioRxiv 2023
[ PubMed ID = 37577634 ]
[ RRC reference ]
|
Kishner M, Habaz L, Meshnik L, Meidan TD, Polonsky A, Ben-Zvi A.
Gonadotropin-releasing hormone-like receptor 2 inversely regulates somatic proteostasis and reproduction in Caenorhabditis elegans.
Front Cell Dev Biol 2022 10 951199
[ PubMed ID = 36105349 ]
[ RRC reference ]
|
Lemieux GA, Keiser MJ, Sassano MF, Laggner C, Mayer F, Bainton RJ, Werb Z, Roth BL, Shoichet BK, Ashrafi K.
In silico molecular comparisons of C. elegans and mammalian pharmacology identify distinct targets that regulate feeding.
PLoS Biol 2013 11(11) e1001712
[ PubMed ID = 24260022 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.