分離済み変異体

tm4844

Allele Nametm4844
BalanceNot Required
OutCrossNot Accepted
Sequence NameY87G2A.7
Gene Namenyn-2
Worm BaseAllele Name tm4844
Gene Name nyn-2
Sequence Y87G2A.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 81633/81634-GGAAAGACGACCACCAGGCACTCGTCTAGTGCTGGAAA-82081/82082 (448 bp deletion + 38 bp insertion)
ChromosomeI
Putative gene structurejoin(81596..82187, 83173..83375, 83433..83858, 84479..84727)
Map position21.46
Balancer
Map position of balancer
Sequence of primersExtRev:TTCGGTAGAGGCTCACACTA,IntRev:GGAATTCTCTAGCCTCACTA,ExtFwd:CGCGGAAATTCGAATGGTGT,IntFwd:AACGCGCAACGCGGGATAGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Lowe DD, Shukla A, Kennedy SG.
Viral RNA pUGylation promotes antiviral immunity in C. elegans.
J Virol 2025 99(11) e0116925 
[ PubMed ID = 41165327 ] [ RRC reference ]

Lowe DD, Newman M, Ruvkun G, Kennedy SG.
The microRNA miR-243 directs poly(UG) modification of a somatic mRNA in C. elegans.
MicroPubl Biol 2025 2025  
[ PubMed ID = 40880989 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Uebel CJ, Anderson DC, Mandarino LM, Manage KI, Aynaszyan S, Phillips CM.
Distinct regions of the intrinsically disordered protein MUT-16 mediate assembly of a small RNA amplification complex and promote phase separation of Mutator foci.
PLoS Genet 2018 14(7) e1007542 
[ PubMed ID = 30036386 ] [ RRC reference ]

Tsai HY, Chen CC, Conte D Jr, Moresco JJ, Chaves DA, Mitani S, Yates JR 3rd, Tsai MD, Mello CC.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Cell 2015 160(3) 407-19 
[ PubMed ID = 25635455 ] [ RRC reference ]