分離済み変異体

tm4803

Allele Nametm4803
BalanceNot Required
OutCrossNot Accepted
Sequence NameZK1193.5
Gene Namedve-1
Worm BaseAllele Name tm4803
Gene Name dve-1
Sequence ZK1193.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22336/22337-22845/22846 (509 bp deletion)
ChromosomeX
Putative gene structurecomplement(join (20302..20363, 20412..20627, 20679..20737, 21086..21144, 21284..21355, 21406..21575, 22125..22272, 22578..22877, 22928..23090, 25459..25568, 25621..25735, 26430..26556, 27198..27378))
Map position-19.89
Balancer
Map position of balancer
Sequence of primersExtFwd:TGCCATATCCGGGGAGGATG,IntFwd:GTGGACCATAATTGTGTCGA,ExtRev:AGGGAGATTGAATGCGTTGT,IntRev:GAAGGGGACCCAGTATAACT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Li Y, Wang C, Fu X, Wu D, He C, Dai W, Yue X, Luo Z, Yang J, Wan QL.
Transgenerational inheritance of mitochondrial hormetic oxidative stress mediated by histone H3K4me3 and H3K27me3 modifications.
Redox Biol 2025 82 103598 
[ PubMed ID = 40112613 ] [ RRC reference ]

Sheng Y, Abreu A, Markovich Z, Ebea P, Davis L, Park E, Sheng P, Xie M, Han SM, Xiao R.
A mitochondrial unfolded protein response-independent role of DVE-1 in longevity regulation.
Cell Rep 2024 43(11) 114889 
[ PubMed ID = 39423131 ] [ RRC reference ]

Alexander KD, Ramachandran S, Biswas K, Lambert CM, Russell J, Oliver DB, Armstrong W, Rettler M, Liu S, Doitsidou M, Bénard C, Walker AK, Francis MM.
The homeodomain transcriptional regulator DVE-1 directs a program for synapse elimination during circuit remodeling.
Nat Commun 2023 14(1) 7520 
[ PubMed ID = 37980357 ] [ RRC reference ]

Lionaki E, Gkikas I, Daskalaki I, Ioannidi MK, Klapa MI, Tavernarakis N.
Mitochondrial protein import determines lifespan through metabolic reprogramming and de novo serine biosynthesis.
Nat Commun 2022 13(1) 651 
[ PubMed ID = 35115503 ] [ RRC reference ]