| Allele Name | tm4802 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C27B7.1 |
| Gene Name | spr-2 |
| Worm Base | Allele Name |
tm4802
|
| Gene Name |
spr-2
|
| Sequence |
C27B7.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 2342/2343-2693/2694 (351 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(1949..2446, 2523..2720, 2770..3012) |
| Map position | 4 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TCGCGTTCTTGACTAGGTCA,ExtRev:CCTTCTTGCCCATCCGCACT,IntFwd:TATGCGCCAGTCAACACTAT,IntRev:CACTTATGTTCCGACGAGGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Kim S, Govindan JA, Tu ZJ, Greenstein D.
SACY-1 DEAD-Box helicase links the somatic control of oocyte meiotic maturation to the sperm-to-oocyte switch and gamete maintenance in Caenorhabditis elegans.
Genetics 2012 192(3) 905-28
[ PubMed ID = 22887816 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.