分離済み変異体

tm4762

Allele Name

tm4762

Balance

Not Required

OutCross

Not Accepted

Sequence Name

F56A8.1

Gene Name

F56A8.1

Worm Base

Allele Name

tm4762

Gene Name

F56A8.1

Sequence

F56A8.1

Phenotype

homozygous viable.

Mutation site

1159/1160-1361/1362 (202 bp deletion)

Chromosome

III

Putative gene structure

join(1162..1419, 1479..1658, 2228..2413, 2457..2566, 3325..3474, 3524..3613, 3677..3893, 4280..4684, 5170..5318, 5370..5460, 5640..5763, 6247..6315, 6363..6454, 6503..6583, 6636..6790, 7736..7813, 7878..8050, 8106..8203, 8251..8370, 8858..9063, 9384..9501)

Map position

21.15

Balancer

Map position of balancer

Sequence of primers

ExtFwd:GTTAGGCCACCAATTTACAG,IntFwd:TTGGGCCATGCGGTTATAGA,ExtRev:GATAGGTGGCTCGCATACAA,IntRev:GGGTTTAACAACTTCCCGAG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Pieroni EM, O'Connor V, Holden-Dye L, Imperadore P, Fiorito G, Dillon J.
Identification of molecular nociceptors in Octopus vulgaris through functional characterisation in Caenorhabditis elegans.
Biol Open 2026 15(1)
[ PubMed ID = 41431869 ] [ RRC reference ]

Chen M, Gong J.
The seminal fluid protein SFP-1 regulates mated hermaphrodite aging and fat metabolism in C. elegans.
EMBO J 2025 44(23) 7181-7210
[ PubMed ID = 41145916 ] [ RRC reference ]

Zou W, Fan Y, Liu J, Cheng H, Hong H, Al-Sheikh U, Li S, Zhu L, Li R, He L, Tang YQ, Zhao G, Zhang Y, Wang F, Zhan R, Zheng X, Kang L.
Anoctamin-1 is a core component of a mechanosensory anion channel complex in C. elegans.
Nat Commun 2025 16(1) 1680
[ PubMed ID = 39956854 ] [ RRC reference ]

Wang Y, Arnold ML, Smart AJ, Wang G, Androwski RJ, Morera A, Nguyen KCQ, Schweinsberg PJ, Bai G, Cooper J, Hall DH, Driscoll M, Grant BD.
Large vesicle extrusions from C. elegans neurons are consumed and stimulated by glial-like phagocytosis activity of the neighboring cell.
Elife 2023 12
[ PubMed ID = 36861960 ] [ RRC reference ]

Furuta Y, Pena-Ramos O, Li Z, Chiao L, Zhou Z.
Calcium ions trigger the exposure of phosphatidylserine on the surface of necrotic cells.
PLoS Genet 2021 17(2) e1009066
[ PubMed ID = 33571185 ] [ RRC reference ]

Kim KW, Tang NH, Piggott CA, Andrusiak MG, Park S, Zhu M, Kurup N, Cherra SJ 3rd, Wu Z, Chisholm AD, Jin Y.
Expanded genetic screening in Caenorhabditis elegans identifies new regulators and an inhibitory role for NAD⁺ in axon regeneration.
Elife 2018 7
[ PubMed ID = 30461420 ] [ RRC reference ]

Li Z, Venegas V, Nagaoka Y, Morino E, Raghavan P, Audhya A, Nakanishi Y, Zhou Z.
Necrotic Cells Actively Attract Phagocytes through the Collaborative Action of Two Distinct PS-Exposure Mechanisms.
PLoS Genet 2015 11(6) e1005285
[ PubMed ID = 26061275 ] [ RRC reference ]

Wang Y, Alam T, Hill-Harfe K, Lopez AJ, Leung CK, Iribarne D, Bruggeman B, Miyamoto MM, Harfe BD, Choe KP.
Phylogenetic, expression, and functional analyses of anoctamin homologs in Caenorhabditis elegans.
Am J Physiol Regul Integr Comp Physiol 2013 305(11) R1376-89
[ PubMed ID = 24049119 ] [ RRC reference ]