Allele Name | tm474 |
Allele Type | 通常株 |
Sequence Name | C40C9.5 |
Gene Name | nlg-1 |
Worm Base | Allele Name |
tm474
|
Gene Name |
nlg-1
|
Sequence |
C40C9.5
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. Y-K. Paik: dauer formed on daumone plate. Dr. J. Rand: thermotaxis-negative, reduced frequency of spontaneous reversals. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| [Y12A6A] 15365/15366-[Y12A6A] 15948/15949 (583 bp deletion) |
Chromosome | X |
Putative gene structure | complement(join(11859..12193, 12237..12346, 13365..13469, 13632..13774, 14265..14525, 14590..14915, 14967..15094, 15258..15509, 15791..15946, 16056..16225, 16510..16641, 16690..16955, 17009..17121, 17269..17401, 17498..[C40C9]217)) |
Map position | 13.99 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:GTGGTTAGCCCCGAAGGAGA,ExtFwd:ATTCTTGTGCAATTGCGGGA,IntFwd:ATCCTACTTGAGCATTCCGA,ExtRev:GGGCATGGTGAGAGGTGAAG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Xiao G, Chen H, Krasteva N, Liu Q, Wang D. Identification of interneurons required for the aversive response of Caenorhabditis elegans to graphene oxide. J Nanobiotechnology 2018 16(1) 45
[ PubMed ID = 29703212 ]
[ RRC reference ]
|
Calahorro F, Alejandre E, Ruiz-Rubio M. Osmotic avoidance in Caenorhabditis elegans: synaptic function of two genes, orthologues of human NRXN1 and NLGN1, as candidates for autism. J Vis Exp 2009 (34)
[ PubMed ID = 20010541 ]
[ RRC reference ]
|
Hunter JW, Mullen GP, McManus JR, Heatherly JM, Duke A, Rand JB. Neuroligin-deficient mutants of C. elegans have sensory processing deficits and are hypersensitive to oxidative stress and mercury toxicity. Dis Model Mech 2010 3(5-6) 366-76
[ PubMed ID = 20083577 ]
[ RRC reference ]
|
Gaertner BE, Parmenter MD, Rockman MV, Kruglyak L, Phillips PC. More than the sum of its parts: a complex epistatic network underlies natural variation in thermal preference behavior in Caenorhabditis elegans. Genetics 2012 192(4) 1533-42
[ PubMed ID = 23086219 ]
[ RRC reference ]
|
Calahorro F, Ruiz-Rubio M. Functional phenotypic rescue of Caenorhabditis elegans neuroligin-deficient mutants by the human and rat NLGN1 genes. PLoS One 2012 7(6) e39277
[ PubMed ID = 22723984 ]
[ RRC reference ]
|
Calahorro F, Ruiz-Rubio M. Caenorhabditis elegans as an experimental tool for the study of complex neurological diseases: Parkinson's disease, Alzheimer's disease and autism spectrum disorder. Invert Neurosci 2011 11(2) 73-83
[ PubMed ID = 22068627 ]
[ RRC reference ]
|
Izquierdo PG, Calahorro F, Ruiz-Rubio M. Neuroligin modulates the locomotory dopaminergic and serotonergic neuronal pathways of C. elegans. Neurogenetics 2013 14(3-4) 233-42
[ PubMed ID = 24100941 ]
[ RRC reference ]
|
|