分離済み変異体

tm474

Allele Nametm474
BalanceNot Required
OutCrossNot Accepted
Sequence NameC40C9.5
Gene Namenlg-1
Worm BaseAllele Name tm474
Gene Name nlg-1
Sequence C40C9.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Y-K. Paik: dauer formed on daumone plate. Dr. J. Rand: thermotaxis-negative, reduced frequency of spontaneous reversals.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y12A6A] 15365/15366-[Y12A6A] 15948/15949 (583 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(11859..12193, 12237..12346, 13365..13469, 13632..13774, 14265..14525, 14590..14915, 14967..15094, 15258..15509, 15791..15946, 16056..16225, 16510..16641, 16690..16955, 17009..17121, 17269..17401, 17498..[C40C9]217))
Map position13.99
Balancer
Map position of balancer
Sequence of primersIntRev:GTGGTTAGCCCCGAAGGAGA,ExtFwd:ATTCTTGTGCAATTGCGGGA,IntFwd:ATCCTACTTGAGCATTCCGA,ExtRev:GGGCATGGTGAGAGGTGAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Muirhead CS, Reddy KC, Guerra S, Rieger M, Hart MP, Srinivasan J, Chalasani SH.
Neurexin drives Caenorhabditis elegans avoidance behavior independently of its post-synaptic binding partner neuroligin.
G3 (Bethesda) 2024 14(8)  
[ PubMed ID = 38781440 ] [ RRC reference ]

Bastien BL, Cowen MH, Hart MP.
Distinct neurexin isoforms cooperate to initiate and maintain foraging activity.
Transl Psychiatry 2023 13(1) 367 
[ PubMed ID = 38036526 ] [ RRC reference ]

Xiao G, Chen H, Krasteva N, Liu Q, Wang D.
Identification of interneurons required for the aversive response of Caenorhabditis elegans to graphene oxide.
J Nanobiotechnology 2018 16(1) 45 
[ PubMed ID = 29703212 ] [ RRC reference ]

Izquierdo PG, Calahorro F, Ruiz-Rubio M.
Neuroligin modulates the locomotory dopaminergic and serotonergic neuronal pathways of C. elegans.
Neurogenetics 2013 14(3-4) 233-42 
[ PubMed ID = 24100941 ] [ RRC reference ]

Gaertner BE, Parmenter MD, Rockman MV, Kruglyak L, Phillips PC.
More than the sum of its parts: a complex epistatic network underlies natural variation in thermal preference behavior in Caenorhabditis elegans.
Genetics 2012 192(4) 1533-42 
[ PubMed ID = 23086219 ] [ RRC reference ]

Calahorro F, Ruiz-Rubio M.
Functional phenotypic rescue of Caenorhabditis elegans neuroligin-deficient mutants by the human and rat NLGN1 genes.
PLoS One 2012 7(6) e39277 
[ PubMed ID = 22723984 ] [ RRC reference ]

Calahorro F, Ruiz-Rubio M.
Caenorhabditis elegans as an experimental tool for the study of complex neurological diseases: Parkinson's disease, Alzheimer's disease and autism spectrum disorder.
Invert Neurosci 2011 11(2) 73-83 
[ PubMed ID = 22068627 ] [ RRC reference ]

Hunter JW, Mullen GP, McManus JR, Heatherly JM, Duke A, Rand JB.
Neuroligin-deficient mutants of C. elegans have sensory processing deficits and are hypersensitive to oxidative stress and mercury toxicity.
Dis Model Mech 2010 3(5-6) 366-76 
[ PubMed ID = 20083577 ] [ RRC reference ]

Calahorro F, Alejandre E, Ruiz-Rubio M.
Osmotic avoidance in Caenorhabditis elegans: synaptic function of two genes, orthologues of human NRXN1 and NLGN1, as candidates for autism.
J Vis Exp 2009 (34)  
[ PubMed ID = 20010541 ] [ RRC reference ]