| Allele Name | tm4719 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | E01A2.4 |
| Gene Name | E01A2.4 |
| Worm Base | Allele Name |
tm4719
(x1) |
| Gene Name |
E01A2.4
|
| Sequence |
E01A2.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 5921/5922-6364/6365 (443 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(4820..4942, 5743..7000, 7192..7253, 7311..7382)) |
| Map position | -1.68 |
| Balancer | hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | IntRev:ACGAATAGTGGCAGCGGGGA,ExtRev:GAGAGAGGTACTTTGCCGTT,IntFwd:TCTCGTCGCCTCCATTGCCT,ExtFwd:GCACCCTTGCTTGGGCCATA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ]
[ RRC reference ]
|
Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ]
[ RRC reference ]
|
Chu JS, Johnsen RC, Chua SY, Tu D, Dennison M, Marra M, Jones SJ, Baillie DL, Rose AM.
Allelic ratios and the mutational landscape reveal biologically significant heterozygous SNVs.
Genetics 2012 190(4) 1225-33
[ PubMed ID = 22267497 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.