分離済み変異体

tm469

Allele Nametm469
BalanceNot Required
OutCrossNot Accepted
Sequence NameF29B9.4
Gene Namepsr-1
Worm BaseAllele Name tm469
Gene Name psr-1
Sequence F29B9.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable, Dr. D. Xue (Science 302, 1563, 2003), Dr. J. Ewbank: normal induction of nlp-29 after infection by D. coniospora.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7569/7570-8537/8538 (968 bp deletion)
ChromosomeIV
Putative gene structurejoin(7527..7684, 7740..7860, 8898..9424, 9604..9847)
Map position0.56
Balancer
Map position of balancer
Sequence of primersExtFwd:TTCACTCCGAAGCTAGTTGT,IntRev:TTTTCGTCCACCACATCGCC,ExtRev:GTGCTCATTTTCTCCGGACA,IntFwd:ACACCCTTCAGCGCTTCTAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ko SH, Cho KA, Li X, Ran Q, Liu Z, Chen L.
GPX modulation promotes regenerative axonal fusion and functional recovery after injury through PSR-1 condensation.
Nat Commun 2025 16(1) 1079 
[ PubMed ID = 39870634 ] [ RRC reference ]

Brar HK, Dey S, Bhardwaj S, Pande D, Singh P, Dey S, Ghosh-Roy A.
Dendrite regeneration in C. elegans is controlled by the RAC GTPase CED-10 and the RhoGEF TIAM-1.
PLoS Genet 2022 18(3) e1010127 
[ PubMed ID = 35344539 ] [ RRC reference ]

Raiders S, Black EC, Bae A, MacFarlane S, Klein M, Shaham S, Singhvi A.
Glia actively sculpt sensory neurons by controlled phagocytosis to tune animal behavior.
Elife 2021 10  
[ PubMed ID = 33759761 ] [ RRC reference ]

Basu A, Dey S, Puri D, Das Saha N, Sabharwal V, Thyagarajan P, Srivastava P, Koushika SP, Ghosh-Roy A.
let-7 miRNA controls CED-7 homotypic adhesion and EFF-1-mediated axonal self-fusion to restore touch sensation following injury.
Proc Natl Acad Sci U S A 2017 114(47) E10206-E10215 
[ PubMed ID = 29109254 ] [ RRC reference ]

Neumann B, Coakley S, Giordano-Santini R, Linton C, Lee ES, Nakagawa A, Xue D, Hilliard MA.
EFF-1-mediated regenerative axonal fusion requires components of the apoptotic pathway.
Nature 2015 517(7533) 219-22 
[ PubMed ID = 25567286 ] [ RRC reference ]

Yang H, Chen YZ, Zhang Y, Wang X, Zhao X, Godfroy JI 3rd, Liang Q, Zhang M, Zhang T, Yuan Q, Ann Royal M, Driscoll M, Xia NS, Yin H, Xue D.
A lysine-rich motif in the phosphatidylserine receptor PSR-1 mediates recognition and removal of apoptotic cells.
Nat Commun 2015 6 5717 
[ PubMed ID = 25564762 ] [ RRC reference ]

Wang X, Li W, Zhao D, Liu B, Shi Y, Chen B, Yang H, Guo P, Geng X, Shang Z, Peden E, Kage-Nakadai E, Mitani S, Xue D.
Caenorhabditis elegans transthyretin-like protein TTR-52 mediates recognition of apoptotic cells by the CED-1 phagocyte receptor.
Nat Cell Biol 2010 12(7) 655-64 
[ PubMed ID = 20526330 ] [ RRC reference ]

Hsu TY, Wu YC.
Engulfment of apoptotic cells in C. elegans is mediated by integrin alpha/SRC signaling.
Curr Biol 2010 20(6) 477-86 
[ PubMed ID = 20226672 ] [ RRC reference ]

Cabello J, Neukomm LJ, Günesdogan U, Burkart K, Charette SJ, Lochnit G, Hengartner MO, Schnabel R.
The Wnt pathway controls cell death engulfment, spindle orientation, and migration through CED-10/Rac.
PLoS Biol 2010 8(2) e1000297 
[ PubMed ID = 20126385 ] [ RRC reference ]

Darland-Ransom M, Wang X, Sun CL, Mapes J, Gengyo-Ando K, Mitani S, Xue D.
Role of C. elegans TAT-1 protein in maintaining plasma membrane phosphatidylserine asymmetry.
Science 2008 320(5875) 528-31 
[ PubMed ID = 18436785 ] [ RRC reference ]

Lu Q, Zhang Y, Hu T, Guo P, Li W, Wang X.
C. elegans Rab GTPase 2 is required for the degradation of apoptotic cells.
Development 2008 135(6) 1069-80 
[ PubMed ID = 18256195 ] [ RRC reference ]

Züllig S, Neukomm LJ, Jovanovic M, Charette SJ, Lyssenko NN, Halleck MS, Reutelingsperger CP, Schlegel RA, Hengartner MO.
Aminophospholipid translocase TAT-1 promotes phosphatidylserine exposure during C. elegans apoptosis.
Curr Biol 2007 17(11) 994-9 
[ PubMed ID = 17540571 ] [ RRC reference ]

Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D.
C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1.
Nat Cell Biol 2007 9(5) 541-9 
[ PubMed ID = 17401362 ] [ RRC reference ]

Wang X, Wu YC, Fadok VA, Lee MC, Gengyo-Ando K, Cheng LC, Ledwich D, Hsu PK, Chen JY, Chou BK, Henson P, Mitani S, Xue D.
Cell corpse engulfment mediated by C. elegans phosphatidylserine receptor through CED-5 and CED-12.
Science 2003 302(5650) 1563-6 
[ PubMed ID = 14645848 ] [ RRC reference ]