| Allele Name | tm463 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | B0286.2 |
| Gene Name | lat-2 |
| Worm Base | Allele Name |
tm463
|
| Gene Name |
lat-2
|
| Sequence |
B0286.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. Y-K. Paik: dauer formed on daumone plate. Dr. M. Peter: does not suppress par-2 (RNAi). |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 2402/2403-3780/3781 (1378 bp deletion) |
| Chromosome | II |
| Putative gene structure | join(1681..1771, 1817..1972, 2391..2674, 3380..3489, 3535..3732, 4020..4217, 4667..4725, 5122..5347, 5724..6049, 6139..6226, 6598..7038, 7540..7617, 8073..8296, 8610..8853, 8900..9764, 10463..10690, 10844..11033, 11079..11206, 11298..11513) |
| Map position | -4.8 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GGCAGACGTTTTTGTGACTA,IntFwd:CGTAGGGCTTACCTTTTAGA,IntRev:CGAGACGGACTAAGTATTAG,ExtRev:AACGGAATGAATGCGCAACC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Govek KW, Nicodemus P, Lin Y, Crawford J, Saturnino AB, Cui H, Zoga K, Hart MP, Camara PG. CAJAL enables analysis and integration of single-cell morphological data using metric geometry. Nat Commun 2023 14(1) 3672
[ PubMed ID = 37339989 ]
[ RRC reference ]
|
Langenhan T, Prömel S, Mestek L, Esmaeili B, Waller-Evans H, Hennig C, Kohara Y, Avery L, Vakonakis I, Schnabel R, Russ AP. Latrophilin signaling links anterior-posterior tissue polarity and oriented cell divisions in the C. elegans embryo. Dev Cell 2009 17(4) 494-504
[ PubMed ID = 19853563 ]
[ RRC reference ]
|
Guest M, Bull K, Walker RJ, Amliwala K, O'Connor V, Harder A, Holden-Dye L, Hopper NA. The calcium-activated potassium channel, SLO-1, is required for the action of the novel cyclo-octadepsipeptide anthelmintic, emodepside, in Caenorhabditis elegans. Int J Parasitol 2007 37(14) 1577-88
[ PubMed ID = 17583712 ]
[ RRC reference ]
|
Labbé JC, Pacquelet A, Marty T, Gotta M. A genomewide screen for suppressors of par-2 uncovers potential regulators of PAR protein-dependent cell polarity in Caenorhabditis elegans. Genetics 2006 174(1) 285-95
[ PubMed ID = 16816419 ]
[ RRC reference ]
|
|