分離済み変異体

tm4539

Allele Nametm4539
BalanceNot Required
OutCrossNot Accepted
Sequence NameD2013.3
Gene NameD2013.3
Worm BaseAllele Name tm4539
Gene Name D2013.3
Sequence D2013.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 18729/18730-18879/18880 (150 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(18080..18157, 18209..18509, 18565..18756, 18985..19218, 19263..19349, 19394..19540, 19821..19864))
Map position1.14
Balancer
Map position of balancer
Sequence of primersExtFwd:TGGTTGATCTGTCAAGGGAT,ExtRev:GTTCGTCACGAGGAGTACAT,IntFwd:GTATCCTACCTCATAGCTTG,IntRev:GTCAGAAAACCAGACGGGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yan J, Bhanshali F, Shuzenji C, Mendenhall TT, Taylor SKB, Ermakova G, Cheng X, Bai P, Diwan G, Seraj D, Meyer JN, Sorensen PH, Hartman JH, Taubert S.
Eukaryotic Elongation Factor 2 Kinase EFK-1/eEF2K promotes starvation resistance by preventing oxidative damage in C. elegans.
Nat Commun 2025 16(1) 1752 
[ PubMed ID = 39966347 ] [ RRC reference ]

Bujarrabal-Dueso A, Sendtner G, Meyer DH, Chatzinikolaou G, Stratigi K, Garinis GA, Schumacher B.
The DREAM complex functions as conserved master regulator of somatic DNA-repair capacities.
Nat Struct Mol Biol 2023 30(4) 475-488 
[ PubMed ID = 36959262 ] [ RRC reference ]

Bianco JN, Schumacher B.
MPK-1/ERK pathway regulates DNA damage response during development through DAF-16/FOXO.
Nucleic Acids Res 2018 46(12) 6129-6139 
[ PubMed ID = 29788264 ] [ RRC reference ]

Scheibye-Knudsen M, Tseng A, Borch Jensen M, Scheibye-Alsing K, Fang EF, Iyama T, Bharti SK, Marosi K, Froetscher L, Kassahun H, Eckley DM, Maul RW, Bastian P, De S, Ghosh S, Nilsen H, Goldberg IG, Mattson MP, Wilson DM 3rd, Brosh RM Jr, Gorospe M, Bohr VA.
Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.
Proc Natl Acad Sci U S A 2016 113(44) 12502-12507 
[ PubMed ID = 27791127 ] [ RRC reference ]

Babu V, Hofmann K, Schumacher B.
A C. elegans homolog of the Cockayne syndrome complementation group A gene.
DNA Repair (Amst) 2014 24 57-62 
[ PubMed ID = 25453470 ] [ RRC reference ]