分離済み変異体

tm4498

Allele Nametm4498
BalanceNot Required
OutCrossNot Accepted
Sequence NameR11G11.14
Gene Namelipl-3
Worm BaseAllele Name tm4498
Gene Name lipl-3
Sequence R11G11.14
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 20206/20207-20398/20399 (192 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(18145..18261, 18308..18445, 18498..18797, 19652..20016, 20065..20169, 20303..20402, 20457..20546))
Map position-20
Balancer
Map position of balancer
Sequence of primersIntFwd:CGTGTGATATGTACTTGCCT,ExtFwd:ATTGTCTACCTCTGCCCTAG,IntRev:ATGGTTTTTGCTCGCCCAAG,ExtRev:CATTGCACCGCAAAGTTCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
DuMez-Kornegay RN, Baker LS, Morris AJ, DeLoach WLM, Dowen RH.
Kombucha Tea-associated microbes remodel host metabolic pathways to suppress lipid accumulation.
PLoS Genet 2024 20(3) e1011003 
[ PubMed ID = 38547054 ] [ RRC reference ]

Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, Boyko A, Mazer T, Ang S, Khopkar R, Javaheri A, Kumar S, Jiang X, Ory D, Mani K, Matkovich SJ, Kornfeld K, Diwan A.
Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival.
PLoS Biol 2019 17(5) e3000245 
[ PubMed ID = 31086360 ] [ RRC reference ]

Palikaras K, Mari M, Petanidou B, Pasparaki A, Filippidis G, Tavernarakis N.
Ectopic fat deposition contributes to age-associated pathology in Caenorhabditis elegans.
J Lipid Res 2017 58(1) 72-80 
[ PubMed ID = 27884963 ] [ RRC reference ]

Seah NE, de Magalhaes Filho CD, Petrashen AP, Henderson HR, Laguer J, Gonzalez J, Dillin A, Hansen M, Lapierre LR.
Autophagy-mediated longevity is modulated by lipoprotein biogenesis.
Autophagy 2016 12(2) 261-72 
[ PubMed ID = 26671266 ] [ RRC reference ]

O'Rourke EJ, Ruvkun G.
MXL-3 and HLH-30 transcriptionally link lipolysis and autophagy to nutrient availability.
Nat Cell Biol 2013 15(6) 668-76 
[ PubMed ID = 23604316 ] [ RRC reference ]