分離済み変異体

tm4477

Allele Nametm4477
BalanceNot Required
OutCrossNot Accepted
Sequence NameC02F5.6
Gene Namehenn-1
Worm BaseAllele Name tm4477
Gene Name henn-1
Sequence C02F5.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7132/7133-7505/7506 (373 bp deletion)
ChromosomeIII
Putative gene structurejoin(6193..6234, 6422..6873, 6928..7086, 7137..7491, 7539..7652, 7726..7863)
Map position-0.36
Balancer
Map position of balancer
Sequence of primersIntRev:AATCAATCGGGATCCCAATC,IntFwd:CCTACGTCGAAGCTTACGAA,ExtRev:TTACCTACCGTTCTCGGTTC,ExtFwd:GGGAGCTCCATATGATAATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Pastore B, Hertz HL, Tang W.
The ribonuclease DISL-2 mediates piRNA degradation in C. elegans.
Cell Rep 2025 44(10) 116430 
[ PubMed ID = 41075248 ] [ RRC reference ]

Pastore B, Hertz HL, Price IF, Tang W.
pre-piRNA trimming and 2'-O-methylation protect piRNAs from 3' tailing and degradation in C. elegans.
Cell Rep 2021 36(9) 109640 
[ PubMed ID = 34469728 ] [ RRC reference ]

Alberti C, Manzenreither RA, Sowemimo I, Burkard TR, Wang J, Mahofsky K, Ameres SL, Cochella L.
Cell-type specific sequencing of microRNAs from complex animal tissues.
Nat Methods 2018 15(4) 283-289 
[ PubMed ID = 29481550 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]

Tang W, Tu S, Lee HC, Weng Z, Mello CC.
The RNase PARN-1 Trims piRNA 3' Ends to Promote Transcriptome Surveillance in C. elegans.
Cell 2016 164(5) 974-84 
[ PubMed ID = 26919432 ] [ RRC reference ]

Billi AC, Freeberg MA, Day AM, Chun SY, Khivansara V, Kim JK.
A conserved upstream motif orchestrates autonomous, germline-enriched expression of Caenorhabditis elegans piRNAs.
PLoS Genet 2013 9(3) e1003392 
[ PubMed ID = 23516384 ] [ RRC reference ]

Billi AC, Alessi AF, Khivansara V, Han T, Freeberg M, Mitani S, Kim JK.
The Caenorhabditis elegans HEN1 ortholog, HENN-1, methylates and stabilizes select subclasses of germline small RNAs.
PLoS Genet 2012 8(4) e1002617 
[ PubMed ID = 22548001 ] [ RRC reference ]