Home > 分離済み変異体 > tm4393

分離済み変異体

Allele Name		tm4393
Balance		Not Required
OutCross		Not Accepted
Sequence Name		F48B9.4
Gene Name		nlp-37
Worm Base	Allele Name	tm4393
	Gene Name	nlp-37
	Sequence	F48B9.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		16637/16638-17038/17039 (401 bp deletion)
Chromosome		X
Putative gene structure		join(16616..16720, 16785..16853, 16904..16999)
Map position		-16.94
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CCGCAGTAGCACATCTCTCA,IntFwd:CCGTAAACCATCAACTCTAG,ExtRev:GTTTCGGTGTCACAGGTGAC,IntRev:CGGTTTTGTGGTAGCCTCAG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Molina-García L, Colinas-Fischer S, Benavides-Laconcha S, Lin L, Clark E, Treloar NJ, García-Minaur-Ortíz B, Butts M, Barnes CP, Barrios A. Conflict during learning reconfigures the neural representation of positive valence and approach behavior. Curr Biol 2024 34(23) 5470-5483.e7  [ PubMed ID = 39547234 ] [ RRC reference ] Huang H, Hayden DJ, Zhu CT, Bennett HL, Venkatachalam V, Skuja LL, Hart AC. Gap Junctions and NCA Cation Channels Are Critical for Developmentally Timed Sleep and Arousal in Caenorhabditis elegans. Genetics 2018 210(4) 1369-1381  [ PubMed ID = 30323068 ] [ RRC reference ] Hilbert ZA, Kim DH. PDF-1 neuropeptide signaling regulates sexually dimorphic gene expression in shared sensory neurons of C. elegans. Elife 2018 7   [ PubMed ID = 30024377 ] [ RRC reference ] Herrero A, Romanowski A, Meelkop E, Caldart CS, Schoofs L, Golombek DA. Pigment-dispersing factor signaling in the circadian system of Caenorhabditis elegans. Genes Brain Behav 2015 14(6) 493-501  [ PubMed ID = 26113231 ] [ RRC reference ] Flavell SW, Pokala N, Macosko EZ, Albrecht DR, Larsch J, Bargmann CI. Serotonin and the neuropeptide PDF initiate and extend opposing behavioral states in C. elegans. Cell 2013 154(5) 1023-1035  [ PubMed ID = 23972393 ] [ RRC reference ] Choi S, Chatzigeorgiou M, Taylor KP, Schafer WR, Kaplan JM. Analysis of NPR-1 reveals a circuit mechanism for behavioral quiescence in C. elegans. Neuron 2013 78(5) 869-80  [ PubMed ID = 23764289 ] [ RRC reference ] Barrios A, Ghosh R, Fang C, Emmons SW, Barr MM. PDF-1 neuropeptide signaling modulates a neural circuit for mate-searching behavior in C. elegans. Nat Neurosci 2012 15(12) 1675-82  [ PubMed ID = 23143519 ] [ RRC reference ] Meelkop E, Temmerman L, Janssen T, Suetens N, Beets I, Van Rompay L, Shanmugam N, Husson SJ, Schoofs L. PDF receptor signaling in Caenorhabditis elegans modulates locomotion and egg-laying. Mol Cell Endocrinol 2012 361(1-2) 232-40  [ PubMed ID = 22579613 ] [ RRC reference ] Frooninckx L, Van Rompay L, Temmerman L, Van Sinay E, Beets I, Janssen T, Husson SJ, Schoofs L. Neuropeptide GPCRs in C. elegans. Front Endocrinol (Lausanne) 2012 3 167  [ PubMed ID = 23267347 ] [ RRC reference ]