| Allele Name | tm4391 |
| Balance | Request Available |
| OutCross | Not Accepted |
| Sequence Name | C34G6.5 |
| Gene Name | C34G6.5 |
| Worm Base | Allele Name |
tm4391
|
| Gene Name |
C34G6.5
|
| Sequence |
C34G6.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| Gro. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 2726/2727-3044/3045 (318 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(2166..2274, 2462..2831, 2877..2937, 2996..3106, 3151..3345, 3636..3819, 3863..3957, 4003..4113) |
| Map position | 0.47 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GTCCTTCACTATGAGCCATC,ExtFwd:TATTATAGGCGAGGGTACGT,ExtRev:GTCACTCGTAGTCCTTCACT,IntFwd:AGGGTACGTTTCCAGCTGAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Liachko NF, McMillan PJ, Strovas TJ, Loomis E, Greenup L, Murrell JR, Ghetti B, Raskind MA, Montine TJ, Bird TD, Leverenz JB, Kraemer BC. The tau tubulin kinases TTBK1/2 promote accumulation of pathological TDP-43. PLoS Genet 2014 10(12) e1004803
[ PubMed ID = 25473830 ]
[ RRC reference ]
|
Liachko NF, McMillan PJ, Guthrie CR, Bird TD, Leverenz JB, Kraemer BC. CDC7 inhibition blocks pathological TDP-43 phosphorylation and neurodegeneration. Ann Neurol 2013 74(1) 39-52
[ PubMed ID = 23424178 ]
[ RRC reference ]
|
|