分離済み変異体

tm4344

Allele Nametm4344
BalanceNot Required
OutCrossNot Accepted
Sequence NameK10D2.2
Gene Namepup-2
Worm BaseAllele Name tm4344
Gene Name pup-2
Sequence K10D2.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19350/19351-TT-19931/19932 (581 bp deletion + 2 bp insertion)
ChromosomeIII
Putative gene structurejoin(18888..18902, 18950..19187, 19263..19329, 19380..19793, 19855..20369, 20418..20575, 20638..20757)
Map position-2.03
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGACCACAAGATCCCTCAC,ExtRev:GAAAGAAACTCCGAGCGCAT,ExtFwd:TCACTGGACACCACTGACCA,IntRev:CTTGGCATATCAACACCTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kelley LH, Houlihan AS, Yongblah KE, Aljiboury AA, Davis SL, Maine EM.
Poly(U) polymerase activity promotes establishment of primordial germ cells and limits somatic PGL granules in the Caenorhabditis elegans embryo.
Dev Biol 2026 529 241-253 
[ PubMed ID = 41109472 ] [ RRC reference ]

Pastore B, Hertz HL, Tang W.
The ribonuclease DISL-2 mediates piRNA degradation in C. elegans.
Cell Rep 2025 44(10) 116430 
[ PubMed ID = 41075248 ] [ RRC reference ]

Kelley LH, Caldas IV, Sullenberger MT, Yongblah KE, Niazi AM, Iyer A, Li Y, Tran PM, Valen E, Ahmed-Braimah YH, Maine EM.
Poly(U) polymerase activity in Caenorhabditis elegans regulates abundance and tailing of sRNA and mRNA.
Genetics 2024 228(2)  
[ PubMed ID = 39067069 ] [ RRC reference ]

Vieux KF, Prothro KP, Kelley LH, Palmer C, Maine EM, Veksler-Lublinsky I, McJunkin K.
Screening by deep sequencing reveals mediators of microRNA tailing in C. elegans.
Nucleic Acids Res 2021 49(19) 11167-11180 
[ PubMed ID = 34586415 ] [ RRC reference ]

Wang Y, Weng C, Chen X, Zhou X, Huang X, Yan Y, Zhu C.
CDE-1 suppresses the production of risiRNA by coupling polyuridylation and degradation of rRNA.
BMC Biol 2020 18(1) 115 
[ PubMed ID = 32887607 ] [ RRC reference ]

Li Y, Maine EM.
The balance of poly(U) polymerase activity ensures germline identity, survival and development in Caenorhabditis elegans.
Development 2018 145(19)  
[ PubMed ID = 30305273 ] [ RRC reference ]

Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]

Van Wynsberghe PM, Kai ZS, Massirer KB, Burton VH, Yeo GW, Pasquinelli AE.
LIN-28 co-transcriptionally binds primary let-7 to regulate miRNA maturation in Caenorhabditis elegans.
Nat Struct Mol Biol 2011 18(3) 302-8 
[ PubMed ID = 21297634 ] [ RRC reference ]