| Allele Name | tm4324 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F46B6.8 |
| Gene Name | lipl-2 |
| Worm Base | Allele Name |
tm4324
|
| Gene Name |
lipl-2
|
| Sequence |
F46B6.8
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 22802/22803-23312/23313 (510 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(22617..22721, 22764..22863, 22922..23026, 23073..23440, 23693..24250) |
| Map position | 2.2 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GTGTGTTCACGTGGAAGCCT,ExtRev:CAGGGATCTGGATCATGTAA,IntFwd:GCTCATCTGATCTCCGGACT,ExtFwd:TCACCGTTGAGATTTGTGTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Romanelli-Cedrez L, Vairoletti F, Salinas G. Rhodoquinone-dependent electron transport chain is essential for Caenorhabditis elegans survival in hydrogen sulfide environments. J Biol Chem 2024 300(9) 107708
[ PubMed ID = 39178951 ]
[ RRC reference ]
|
Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, Boyko A, Mazer T, Ang S, Khopkar R, Javaheri A, Kumar S, Jiang X, Ory D, Mani K, Matkovich SJ, Kornfeld K, Diwan A. Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival. PLoS Biol 2019 17(5) e3000245
[ PubMed ID = 31086360 ]
[ RRC reference ]
|
|