| Allele Name | tm4302 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | F44E2.7 |
| Gene Name | F44E2.7 |
| Worm Base | Allele Name |
tm4302
(x1) |
| Gene Name |
F44E2.7
|
| Sequence |
F44E2.7
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 19983/19984-TT-20251/20252 (268 bp deletion + 2 bp insertion) |
| Chromosome | III |
| Putative gene structure | complement(join(19487..19772, 19830..20022, 20072..20170, 20215..20796, 21554..21777, 21826..21857)) |
| Map position | -0.04 |
| Balancer | hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | IntRev:AGTTCCCGCTTCTCCTATGT,ExtFwd:CAGGATTCTGTCACGGAACA,IntFwd:GTCCGCGTTGGTGGCGTTTT,ExtRev:ACTGCGCATAGACCAGATGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Cao W, Fan Q, Amparado G, Begic D, Godini R, Gopal S, Pocock R. A nucleic acid binding protein map of germline regulation in Caenorhabditis elegans. Nat Commun 2024 15(1) 6884
[ PubMed ID = 39128930 ]
[ RRC reference ]
|
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Beurton F, Stempor P, Caron M, Appert A, Dong Y, Chen RA, Cluet D, Couté Y, Herbette M, Huang N, Polveche H, Spichty M, Bedet C, Ahringer J, Palladino F. Physical and functional interaction between SET1/COMPASS complex component CFP-1 and a Sin3S HDAC complex in C. elegans. Nucleic Acids Res 2019 47(21) 11164-11180
[ PubMed ID = 31602465 ]
[ RRC reference ]
|
|