分離済み変異体

tm4287

Allele Nametm4287
BalanceNot Required
OutCrossNot Accepted
Sequence NameC28H8.9
Gene NameC28H8.9
Worm BaseAllele Name tm4287
Gene Name C28H8.9
Sequence C28H8.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 23032/23033-23350/23351 (318 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(21184..21333, 21385..21617, 21665..21754, 22547..22649, 22699..22904, 22955..23208, 23335..23417))
Map position-1.44
Balancer
Map position of balancer
Sequence of primersExtRev:GACAATACGCAATTTCGCGT,IntRev:GTACATCGGCAGCTGTCCAA,ExtFwd:TAGTGTTCCCGGTAACTGAC,IntFwd:CGATGGGGGAGGCAAATAAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Osuma A, Destain H, Mann J, Li Y, Taylor SR, Prahlad M, Weigle IQ, Marques F, Schulz NG, Mathies LD, Islam P, Brown AEX, Smith JJ, Kratsios P.
Cell type-specific functions of the PBAF chromatin-remodeling complex in neuronal diversification.
Nat Commun 2025 17(1) 741 
[ PubMed ID = 41390837 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Villanueva-Chimal E, Salinas LS, Fernández-Cardenas LP, Huelgas-Morales G, Cabrera-Wrooman A, Navarro RE.
DPFF-1 transcription factor deficiency causes the aberrant activation of MPK-1 and meiotic defects in the Caenorhabditis elegans germline.
Genesis 2017 55(11)  
[ PubMed ID = 28940692 ] [ RRC reference ]

Mathies LD, Blackwell GG, Austin MK, Edwards AC, Riley BP, Davies AG, Bettinger JC.
SWI/SNF chromatin remodeling regulates alcohol response behaviors in Caenorhabditis elegans and is associated with alcohol dependence in humans.
Proc Natl Acad Sci U S A 2015 112(10) 3032-7 
[ PubMed ID = 25713357 ] [ RRC reference ]