分離済み変異体

tm4259

Allele Nametm4259
Allele Type通常株
Sequence NameF52D2.4
Gene Namegei-12
Worm BaseAllele Name tm4259
Gene Name gei-12
Sequence F52D2.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 40176/40177-ATGCT-40803/40804 (627 bp deletion + 5 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(38393..38718, 38767..39056, 39188..39322, 39371..39517, 39564..39674, 39721..41242, 41288..41345))
Map position-17.16
Balancer
Map position of balancer
Sequence of primersIntRev:GCGGTCTGCCAAACTCGAGA,IntFwd:CTTGCTGGATGATGTCAGAC,ExtRev:AACCTTACCCAAGCGGTCTG,ExtFwd:AACCACGCCAAGTGACTTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang SY, Kim K, O'Brown ZK, Levan A, Dodson AE, Kennedy SG, Chernoff C, Greer EL.
Hypoxia induces transgenerational epigenetic inheritance of small RNAs.
Cell Rep 2022 41(11) 111800 
[ PubMed ID = 36516753 ] [ RRC reference ]

Cassani M, Seydoux G.
Specialized germline P-bodies are required to specify germ cell fate in Caenorhabditis elegans embryos.
Development 2022 149(21)  
[ PubMed ID = 36196602 ] [ RRC reference ]

Toker IA, Lev I, Mor Y, Gurevich Y, Fisher D, Houri-Zeevi L, Antonova O, Doron H, Anava S, Gingold H, Hadany L, Shaham S, Rechavi O.
Transgenerational inheritance of sexual attractiveness via small RNAs enhances evolvability in C. elegans.
Dev Cell 2022 57(3) 298-309.e9 
[ PubMed ID = 35134343 ] [ RRC reference ]

Lev I, Toker IA, Mor Y, Nitzan A, Weintraub G, Antonova O, Bhonkar O, Ben Shushan I, Seroussi U, Claycomb JM, Anava S, Gingold H, Zaidel-Bar R, Rechavi O.
Germ Granules Govern Small RNA Inheritance.
Curr Biol 2019 29(17) 2880-2891.e4 
[ PubMed ID = 31378614 ] [ RRC reference ]

Lee CS, Putnam A, Lu T, He S, Ouyang JPT, Seydoux G.
Recruitment of mRNAs to P granules by condensation with intrinsically-disordered proteins.
Elife 2020 9  
[ PubMed ID = 31975687 ] [ RRC reference ]

Dodson AE, Kennedy S.
Germ Granules Coordinate RNA-Based Epigenetic Inheritance Pathways.
Dev Cell 2019 50(6) 704-715.e4 
[ PubMed ID = 31402284 ] [ RRC reference ]

Wan G, Fields BD, Spracklin G, Shukla A, Phillips CM, Kennedy S.
Spatiotemporal regulation of liquid-like condensates in epigenetic inheritance.
Nature 2018 557(7707) 679-683 
[ PubMed ID = 29769721 ] [ RRC reference ]

Chen JX, Cipriani PG, Mecenas D, Polanowska J, Piano F, Gunsalus KC, Selbach M.
In Vivo Interaction Proteomics in Caenorhabditis elegans Embryos Provides New Insights into P Granule Dynamics.
Mol Cell Proteomics 2016 15(5) 1642-57 
[ PubMed ID = 26912668 ] [ RRC reference ]