分離済み変異体

tm4255

Allele Nametm4255
BalanceNot Required
OutCrossNot Accepted
Sequence NameY104H12BR.1
Gene Nameplst-1
Worm BaseAllele Name tm4255
Gene Name plst-1
Sequence Y104H12BR.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3985/3986-4353/4354 (368 bp deletion)
ChromosomeIV
Putative gene structurejoin(2146..2278, 3936..4312, 5193..5309)
Map position-20.56
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCAAAAGAGCTCAGCTTGC,IntFwd:CGTTACAGATATCTACGACG,ExtRev:CCTTGCTTCATATCGGGAAG,IntRev:GTCACGAGCCATTAGACATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Geisler F, Coch RA, Richardson C, Goldberg M, Bevilacqua C, Prevedel R, Leube RE.
Intestinal intermediate filament polypeptides in C. elegans: Common and isotype-specific contributions to intestinal ultrastructure and function.
Sci Rep 2020 10(1) 3142 
[ PubMed ID = 32081918 ] [ RRC reference ]

Leite J, Chan FY, Osório DS, Saramago J, Sobral AF, Silva AM, Gassmann R, Carvalho AX.
Equatorial Non-muscle Myosin II and Plastin Cooperate to Align and Compact F-actin Bundles in the Cytokinetic Ring.
Front Cell Dev Biol 2020 8 573393 
[ PubMed ID = 33102479 ] [ RRC reference ]

Priti A, Ong HT, Toyama Y, Padmanabhan A, Dasgupta S, Krajnc M, Zaidel-Bar R.
Syncytial germline architecture is actively maintained by contraction of an internal actomyosin corset.
Nat Commun 2018 9(1) 4694 
[ PubMed ID = 30410005 ] [ RRC reference ]

Ding WY, Ong HT, Hara Y, Wongsantichon J, Toyama Y, Robinson RC, Nédélec F, Zaidel-Bar R.
Plastin increases cortical connectivity to facilitate robust polarization and timely cytokinesis.
J Cell Biol 2017 216(5) 1371-1386 
[ PubMed ID = 28400443 ] [ RRC reference ]

Gallotta I, Mazzarella N, Donato A, Esposito A, Chaplin JC, Castro S, Zampi G, Battaglia GS, Hilliard MA, Bazzicalupo P, Di Schiavi E.
Neuron-specific knock-down of SMN1 causes neuron degeneration and death through an apoptotic mechanism.
Hum Mol Genet 2016 25(12) 2564-2577 
[ PubMed ID = 27260405 ] [ RRC reference ]

Dimitriadi M, Sleigh JN, Walker A, Chang HC, Sen A, Kalloo G, Harris J, Barsby T, Walsh MB, Satterlee JS, Li C, Van Vactor D, Artavanis-Tsakonas S, Hart AC.
Conserved genes act as modifiers of invertebrate SMN loss of function defects.
PLoS Genet 2010 6(10) e1001172 
[ PubMed ID = 21124729 ] [ RRC reference ]