分離済み変異体

tm4248

Allele Nametm4248
BalanceNot Required
OutCrossNot Accepted
Sequence NameK02F3.4
Gene Namezip-2
Worm BaseAllele Name tm4248
Gene Name zip-2
Sequence K02F3.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Kaplan: non-Egl, non-Dpy, non-Sma.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12299/12300-12521/12522 (222 bp deletion)
ChromosomeIII
Putative gene structurejoin(11760..11768, 11821..12136, 12193..12513, 12628..12908)
Map position-25.78
Balancer
Map position of balancer
Sequence of primersExtRev:TAGTCCTCGACTTGAGTCTC,IntRev:TTCGCTTCTCTAGACGCTCT,ExtFwd:CAGTGTTGCTTCATGGACGA,IntFwd:CCAAGTATGGAGCCGGTTAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Yan J, Bhanshali F, Shuzenji C, Mendenhall TT, Taylor SKB, Ermakova G, Cheng X, Bai P, Diwan G, Seraj D, Meyer JN, Sorensen PH, Hartman JH, Taubert S.
Eukaryotic Elongation Factor 2 Kinase EFK-1/eEF2K promotes starvation resistance by preventing oxidative damage in C. elegans.
Nat Commun 2025 16(1) 1752 
[ PubMed ID = 39966347 ] [ RRC reference ]

Kniazeva M, Ruvkun G.
Translation elongation defects activate the Caenorhabditis elegans ZIP-2 bZIP transcription factor-mediated toxin defense.
Proc Natl Acad Sci U S A 2025 122(6) e2423578122 
[ PubMed ID = 39899724 ] [ RRC reference ]

Ji Z, Wang B, Chandra R, Liu J, Yang S, Long Y, Egan M, L'Etoile N, Ma DK.
Non-Visual Light Sensing Enhances Behavioral Memory and Drives Gene Expression in C. elegans.
bioRxiv 2025   
[ PubMed ID = 39975403 ] [ RRC reference ]

Ghosh A, Singh J.
Translation initiation or elongation inhibition triggers contrasting effects on Caenorhabditis elegans survival during pathogen infection.
mBio 2024 15(11) e0248524 
[ PubMed ID = 39347574 ] [ RRC reference ]

Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Zhang L, Gade V, Kirienko NV.
Pathogen-induced dormancy in liquid limits gastrointestinal colonization of Caenorhabditis elegans.
Virulence 2023 14(1) 2204004 
[ PubMed ID = 37096826 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Prakash D, Ms A, Radhika B, Venkatesan R, Chalasani SH, Singh V.
1-Undecene from Pseudomonas aeruginosa is an olfactory signal for flight-or-fight response in Caenorhabditis elegans.
EMBO J 2021 40(13) e106938 
[ PubMed ID = 34086368 ] [ RRC reference ]

Tjahjono E, Kirienko NV.
A conserved mitochondrial surveillance pathway is required for defense against Pseudomonas aeruginosa.
PLoS Genet 2017 13(6) e1006876 
[ PubMed ID = 28662060 ] [ RRC reference ]

McEwan DL, Feinbaum RL, Stroustrup N, Haas W, Conery AL, Anselmo A, Sadreyev R, Ausubel FM.
Tribbles ortholog NIPI-3 and bZIP transcription factor CEBP-1 regulate a Caenorhabditis elegans intestinal immune surveillance pathway.
BMC Biol 2016 14(1) 105 
[ PubMed ID = 27927200 ] [ RRC reference ]

Reddy KC, Dunbar TL, Nargund AM, Haynes CM, Troemel ER.
The C. elegans CCAAT-Enhancer-Binding Protein Gamma Is Required for Surveillance Immunity.
Cell Rep 2016 14(7) 1581-1589 
[ PubMed ID = 26876169 ] [ RRC reference ]

Kirienko NV, Ausubel FM, Ruvkun G.
Mitophagy confers resistance to siderophore-mediated killing by Pseudomonas aeruginosa.
Proc Natl Acad Sci U S A 2015 112(6) 1821-6 
[ PubMed ID = 25624506 ] [ RRC reference ]

Pellegrino MW, Nargund AM, Kirienko NV, Gillis R, Fiorese CJ, Haynes CM.
Mitochondrial UPR-regulated innate immunity provides resistance to pathogen infection.
Nature 2014 516(7531) 414-7 
[ PubMed ID = 25274306 ] [ RRC reference ]

McEwan DL, Kirienko NV, Ausubel FM.
Host translational inhibition by Pseudomonas aeruginosa Exotoxin A Triggers an immune response in Caenorhabditis elegans.
Cell Host Microbe 2012 11(4) 364-74 
[ PubMed ID = 22520464 ] [ RRC reference ]

Dunbar TL, Yan Z, Balla KM, Smelkinson MG, Troemel ER.
C. elegans detects pathogen-induced translational inhibition to activate immune signaling.
Cell Host Microbe 2012 11(4) 375-86 
[ PubMed ID = 22520465 ] [ RRC reference ]