| Allele Name | tm424 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | E03A3.2 |
| Gene Name | rcq-5 |
| Worm Base | Allele Name |
tm424
|
| Gene Name |
rcq-5
|
| Sequence |
E03A3.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. S. Ahmed: Not hypersensitive to ionizing radiation. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 12982/12983-13579/13580 (597 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(10679..10780, 10831..10998, 11703..12026, 12071..12188, 12537..12634, 12687..12855, 13206..13528, 13867..14038, 14468..14993, 15246..15528, 15574..15720)) |
| Map position | -4.01 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:CGATGGAGACCAGTGAATTA,ExtFwd:TATCCTGCCAGATTTTGCGA,ExtRev:GACGAGGAGACCGACAAAGA,IntRev:AGCCAGCTGCGAAGAAACCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Ye FB, Hamza A, Singh T, Flibotte S, Hieter P, O'Neil NJ.
A Multimodal Genotoxic Anticancer Drug Characterized by Pharmacogenetic Analysis in Caenorhabditis elegans.
Genetics 2020 215(3) 609-621
[ PubMed ID = 32414869 ]
[ RRC reference ]
|
León-Ortiz AM, Panier S, Sarek G, Vannier JB, Patel H, Campbell PJ, Boulton SJ.
A Distinct Class of Genome Rearrangements Driven by Heterologous Recombination.
Mol Cell 2018 69(2) 292-305.e6
[ PubMed ID = 29351848 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.