分離済み変異体

tm423

Allele Nametm423
BalanceRequest Available
OutCrossNot Accepted
Sequence NameC01G5.8
Gene Namefan-1
Worm BaseAllele Name tm423
Gene Name fan-1
Sequence C01G5.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 36309/36310-36720/36721 (411 bp deletion)
ChromosomeIV
Putative gene structurejoin(35084..35191, 35239..35331, 35380..35516, 35564..35825, 35878..36199, 36245..36339, 36397..36555, 36640..36728, 36780..36881, 36929..37206, 37250..37329, 37375..37681, 37991..38295, 38345..38605)
Map position3.2
Balancer
Map position of balancer
Sequence of primersExtRev:GACGGGAGAATCAATCGATT,ExtFwd:CAGATCTGTCCATTGTGCGA,IntFwd:CGAGACGAAATTCTCTCTAG,IntRev:AACGAAAAGCTTAGGTGACG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Ye FB, Hamza A, Singh T, Flibotte S, Hieter P, O'Neil NJ.
A Multimodal Genotoxic Anticancer Drug Characterized by Pharmacogenetic Analysis in Caenorhabditis elegans.
Genetics 2020 215(3) 609-621 
[ PubMed ID = 32414869 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Lawrence KS, Tapley EC, Cruz VE, Li Q, Aung K, Hart KC, Schwartz TU, Starr DA, Engebrecht J.
LINC complexes promote homologous recombination in part through inhibition of nonhomologous end joining.
J Cell Biol 2016 215(6) 801-821 
[ PubMed ID = 27956467 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9 
[ PubMed ID = 24768858 ] [ RRC reference ]

Smogorzewska A, Desetty R, Saito TT, Schlabach M, Lach FP, Sowa ME, Clark AB, Kunkel TA, Harper JW, Colaiácovo MP, Elledge SJ.
A genetic screen identifies FAN1, a Fanconi anemia-associated nuclease necessary for DNA interstrand crosslink repair.
Mol Cell 2010 39(1) 36-47 
[ PubMed ID = 20603073 ] [ RRC reference ]

Kratz K, Schöpf B, Kaden S, Sendoel A, Eberhard R, Lademann C, Cannavó E, Sartori AA, Hengartner MO, Jiricny J.
Deficiency of FANCD2-associated nuclease KIAA1018/FAN1 sensitizes cells to interstrand crosslinking agents.
Cell 2010 142(1) 77-88 
[ PubMed ID = 20603016 ] [ RRC reference ]