分離済み変異体

tm420

Allele Name

tm420

Balance

Not Required

OutCross

Not Accepted

Sequence Name

W06D12.3

Gene Name

fat-5

Worm Base

Allele Name

tm420

Gene Name

fat-5

Sequence

W06D12.3

Phenotype

homozygous viable. Dr. H. Arai: WT (Brood size, embryonic lethality, larval lehtality, growth rate), Dr. M. Han: slow growth, dumpish, mono-unsaturated fatty acids N17 are decreased. Dr. K. Sakamoto: J. Biochem 144, 149 (2008). Dr. J. Watts & Dr. J. Browse: PLoS Genetics 2, e108 (2006), Genetics 176, 865 (2007).

Mutation site

19998/19999-20777/20778 (779 bp deletion)

Chromosome

Putative gene structure

join(19946..20159, 20215..20551, 21208..21658)

Map position

13.08

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TCACACAACTTGTTTGCCTC,IntFwd:ACAGACTCCGCCCCTTCTTT,IntRev:CGACCGAATTTTGGGCAAAA,ExtRev:GGATTGGCCTAGCCCAAACT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Jiang WI, Vale GDD, Pearce Q, Kong K, Zhou W, McDonald JG, Cox JE, Singhal NS, Ma DK.
Conserved lipid metabolic reprogramming confers hypoxic and aging resilience.
EMBO Rep 2026 27(3) 704-728
[ PubMed ID = 41381735 ] [ RRC reference ]

Li KUR, Lo WK, Yang M, Wang C, Lau CY, Lee JC, Zheng C.
Microbacterium diet rich in branched chain fatty acids promotes lipid droplet enlargement and impacts organismal health in C. elegans.
Cell Rep 2025 44(10) 116292
[ PubMed ID = 40960936 ] [ RRC reference ]

Zhu T, Wang Z, Li J, Zhao Y, Fan S.
FAT-5/SCD5-mediated lipid localization in lysosomes alleviates gamma radiation injury in Caenorhabditis elegans.
J Biol Chem 2025 301(10) 110674
[ PubMed ID = 40907895 ] [ RRC reference ]

An L, Geng B, An L, Wang Y, Zhang Z, Fu X, Chen J, Ma J.
Low molecular weight protein tyrosine phosphatase: A driver of lipid metabolic remodeling in Caenorhabditis elegans.
Int J Biol Macromol 2025 306(Pt 1) 141332
[ PubMed ID = 39988157 ] [ RRC reference ]

Li Q, Zhou X, Zhang X, Zhang C, Zhang SO.
Nuclear receptor signaling regulates compartmentalized phosphatidylcholine remodeling to facilitate thermosensitive lipid droplet fusion.
Nat Commun 2025 16(1) 3955
[ PubMed ID = 40289189 ] [ RRC reference ]

Battista B, Hernandez-Cravero B, Colaiácovo MP, Cochella L, Binolfi A, de Mendoza D.
An inducible and reversible system to regulate unsaturated fatty acid biosynthesis in C. elegans.
G3 (Bethesda) 2025 15(4)
[ PubMed ID = 40097139 ] [ RRC reference ]

Zhang L, Yu J, Gao X, Yan Y, Wang X, Shi H, Fang M, Liu Y, Kim YB, Zhu H, Wu X, Huang C, Fan S.
Targeting farnesoid X receptor as aging intervention therapy.
Acta Pharm Sin B 2025 15(3) 1359-1382
[ PubMed ID = 40370561 ] [ RRC reference ]

Ruan M, Xu F, Li N, Yu J, Teng F, Tang J, Huang C, Zhu H.
Free long-chain fatty acids trigger early postembryonic development in starved Caenorhabditis elegans by suppressing mTORC1.
PLoS Biol 2024 22(10) e3002841
[ PubMed ID = 39436954 ] [ RRC reference ]

Zhou H, Yang Y, Kang Y, Guo T, Zhou Y, Zhang Y, Ma L.
Synergistic toxicity induced by the co-exposure of tenuazonic acid and patulin in Caenorhabditis elegans: Daf-16 plays an important regulatory role.
Ecotoxicol Environ Saf 2024 270 115871
[ PubMed ID = 38141335 ] [ RRC reference ]

Foster SG, Mathew S, Labarre A, Parker JA, Tompkins TA, Binda S.
Lacticaseibacillus rhamnosus HA-114 and Bacillus subtilis R0179 Prolong Lifespan and Mitigate Amyloid-β Toxicity in C. elegans via Distinct Mechanisms.
J Alzheimers Dis 2024 101(1) 49-60
[ PubMed ID = 39093068 ] [ RRC reference ]

Weng JW, Park H, Valotteau C, Chen RT, Essmann CL, Pujol N, Sternberg PW, Chen CH.
Body stiffness is a mechanical property that facilitates contact-mediated mate recognition in Caenorhabditis elegans.
Curr Biol 2023 33(17) 3585-3596.e5
[ PubMed ID = 37541249 ] [ RRC reference ]

Shi H, Zhao J, Li Y, Li J, Li Y, Zhang J, Qiu Z, Wu C, Qin M, Liu C, Zeng Z, Zhang C, Gao L.
Ginsenosides Rg1 regulate lipid metabolism and temperature adaptation in Caenorhabditis elegans.
J Ginseng Res 2023 47(4) 524-533
[ PubMed ID = 37397410 ] [ RRC reference ]

Zhao L, Wu B, Liang S, Min D, Jiang H.
Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans.
Foods 2022 11(24)
[ PubMed ID = 36553826 ] [ RRC reference ]

Casorla-Perez LA, Guennoun R, Cubillas C, Peng B, Kornfeld K, Wang D.
Orsay Virus Infection of Caenorhabditis elegans Is Modulated by Zinc and Dependent on Lipids.
J Virol 2022 96(22) e0121122
[ PubMed ID = 36342299 ] [ RRC reference ]

Goncalves J, Wan Y, Garcia LR.
Stearoyl-CoA desaturases sustain cholinergic excitation and copulatory robustness in metabolically aging C. elegansmales.
iScience 2022 25(4) 104082
[ PubMed ID = 35372802 ] [ RRC reference ]

Wan QL, Meng X, Wang C, Dai W, Luo Z, Yin Z, Ju Z, Fu X, Yang J, Ye Q, Zhang ZH, Zhou Q.
Histone H3K4me3 modification is a transgenerational epigenetic signal for lipid metabolism in Caenorhabditis elegans.
Nat Commun 2022 13(1) 768
[ PubMed ID = 35140229 ] [ RRC reference ]

Mudd N, Liceaga AM.
Caenorhabditis elegans as an in vivo model for food bioactives: A review.
Curr Res Food Sci 2022 5 845-856
[ PubMed ID = 35619588 ] [ RRC reference ]

Qu Z, Zhang L, Huang W, Zheng S.
Vitamin K2 Enhances Fat Degradation to Improve the Survival of C. elegans.
Front Nutr 2022 9 858481
[ PubMed ID = 35495953 ] [ RRC reference ]

Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10
[ PubMed ID = 34236316 ] [ RRC reference ]

Yue Y, Hao G, Cho J, Park Y.
Curcumin reduced fat accumulation in Caenorhabditis elegans.
Curr Res Food Sci 2021 4 551-556
[ PubMed ID = 34458861 ] [ RRC reference ]