| Allele Name | tm415 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C26C6.1 |
| Gene Name | pbrm-1 |
| Worm Base | Allele Name |
tm415
|
| Gene Name |
pbrm-1
|
| Sequence |
C26C6.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. J. Ahringer: low percentage Pvl and Rup adults (might be from side mutation). Dr. H. Sawa: weak Psa, One arm gonad. Dr. W. Vermeulen: partial Lva. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 945/946-CTCTC-1372/1373 (427 bp deletion, 5 bp insertion) |
| Chromosome | I |
| Putative gene structure | join(Z72517:29638..29763, Z72517:29810..30567, 105..344, 397..739, 796..1322, 1401..2346, 2395..3152, 3345..3520, 3570..3670, 3718..3789, 5050..5460, 5558..5771, 5855..6291, 6338..6624, 6677..6800, 6847..6966) |
| Map position | 2.1 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:GTTACGCTGGCTGACAACTT,IntRev:AACCACTCAGAACCGCTGAA,ExtFwd:CTGTTCACGAGAAAGATCGA,ExtRev:AGCAAACCAGCAGCCGGAAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Enríquez P, Krajewski K, Strahl BD, Rothbart SB, Dowen RH, Rose RB.
Binding specificity and function of the SWI/SNF subunit SMARCA4 bromodomain interaction with acetylated histone H3K14.
J Biol Chem 2021 297(4) 101145
[ PubMed ID = 34473995 ]
[ RRC reference ]
|
Mathies LD, Blackwell GG, Austin MK, Edwards AC, Riley BP, Davies AG, Bettinger JC.
SWI/SNF chromatin remodeling regulates alcohol response behaviors in Caenorhabditis elegans and is associated with alcohol dependence in humans.
Proc Natl Acad Sci U S A 2015 112(10) 3032-7
[ PubMed ID = 25713357 ]
[ RRC reference ]
|
Large EE, Mathies LD.
Caenorhabditis elegans SWI/SNF subunits control sequential developmental stages in the somatic gonad.
G3 (Bethesda) 2014 4(3) 471-83
[ PubMed ID = 24402584 ]
[ RRC reference ]
|
Shibata Y, Uchida M, Takeshita H, Nishiwaki K, Sawa H.
Multiple functions of PBRM-1/Polybromo- and LET-526/Osa-containing chromatin remodeling complexes in C. elegans development.
Dev Biol 2012 361(2) 349-57
[ PubMed ID = 22119053 ]
[ RRC reference ]
|
Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W.
Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development.
PLoS Genet 2010 6(5) e1000941
[ PubMed ID = 20463888 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.