分離済み変異体

tm4144

Allele Name

tm4144

Balance

Not Required

OutCross

Not Accepted

Sequence Name

ZK1251.11

Gene Name

ins-8

Worm Base

Allele Name

tm4144

Gene Name

ins-8

Sequence

ZK1251.11

Phenotype

homozygous viable.

Mutation site

9071/9072-9573/9574 (502 bp deletion)

Chromosome

Putative gene structure

complement(join(9157..9236, 9285..9519, 9663..9761))

Map position

4.35

Balancer

Map position of balancer

Sequence of primers

IntRev:GGAGCCTAATCGGTTCATAA,ExtRev:GGTCCATAGAGATGCAAGAC,IntFwd:GGCGACAAGCTTAATATCAG,ExtFwd:GTGAGAGAGGGGAATCCCAA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178
[ PubMed ID = 35511794 ] [ RRC reference ]

Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch'ng Q, Butcher RA, Zhang Y.
Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides.
Neuron 2019 104(6) 1095-1109.e5
[ PubMed ID = 31676170 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330
[ PubMed ID = 28131836 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79
[ PubMed ID = 24671950 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225
[ PubMed ID = 24675767 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60
[ PubMed ID = 23665919 ] [ RRC reference ]

Ritter AD, Shen Y, Fuxman Bass J, Jeyaraj S, Deplancke B, Mukhopadhyay A, Xu J, Driscoll M, Tissenbaum HA, Walhout AJ.
Complex expression dynamics and robustness in C. elegans insulin networks.
Genome Res 2013 23(6) 954-65
[ PubMed ID = 23539137 ] [ RRC reference ]