分離済み変異体

tm4063

Allele Nametm4063
BalanceCompleted
OutCrossNot Accepted
Sequence NameM142.1
Gene Nameunc-119
Worm BaseAllele Name tm4063 (x1)
Gene Name unc-119
Sequence M142.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4197/4198-ATTAAC-4807/4808 (610 bp deletion + 6 bp insertion)
ChromosomeIII
Putative gene structurejoin(3511..3570, 4639..4750, 4821..5201, 5689..5795)
Map position5.57
BalancerhT2
Map position of balancer
Sequence of primersIntFwd:GGTTCAATCAGGGGTGGCAC,ExtFwd:CCTTTCGGTGGTTCAATCAG,IntRev:TCTCTTCGATGCACCATGAG,ExtRev:ATCGGAGCGGGTCTCGTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yan J, Bhanshali F, Shuzenji C, Mendenhall TT, Taylor SKB, Ermakova G, Cheng X, Bai P, Diwan G, Seraj D, Meyer JN, Sorensen PH, Hartman JH, Taubert S.
Eukaryotic Elongation Factor 2 Kinase EFK-1/eEF2K promotes starvation resistance by preventing oxidative damage in C. elegans.
Nat Commun 2025 16(1) 1752 
[ PubMed ID = 39966347 ] [ RRC reference ]

Zhao C, Luo J, Zhang Y, Yu Y.
Temperature-dependent lifespan extension is achieved in miR-80-deleted Caenorhabditis elegans by NLP-45 to modulate endoplasmic reticulum unfolded protein responses.
Aging Cell 2025 24(1) e14345 
[ PubMed ID = 39323014 ] [ RRC reference ]

Aguilar GR, Vidal B, Ji H, Evenblij J, Liao CP, Ji H, Valperga G, Fang-Yen C, Hobert O.
Functional analysis of conserved C. elegans bHLH family members uncovers lifespan control by a peptidergic hub neuron.
PLoS Biol 2025 23(1) e3002979 
[ PubMed ID = 39761329 ] [ RRC reference ]

Lee HMT, Lim HY, He H, Lau CY, Zheng C.
MBL-1/Muscleblind regulates neuronal differentiation and controls the splicing of a terminal selector in Caenorhabditis elegans.
PLoS Genet 2024 20(10) e1011276 
[ PubMed ID = 39423233 ] [ RRC reference ]

Aguilar GR, Vidal B, Ji H, Evenblij J, Ji H, Valperga G, Liao CP, Fang-Yen C, Hobert O.
Functional analysis of conserved C. elegans bHLH family members uncovers lifespan control by a peptidergic hub neuron.
bioRxiv 2024   
[ PubMed ID = 39071424 ] [ RRC reference ]

Yu X, Zhou J, Ye W, Xu J, Li R, Huang L, Chai Y, Wen M, Xu S, Zhou Y.
Time-course swRNA-seq uncovers a hierarchical gene regulatory network in controlling the response-repair-remodeling after wounding.
Commun Biol 2024 7(1) 694 
[ PubMed ID = 38844830 ] [ RRC reference ]

Catela C, Assimacopoulos S, Chen Y, Tsioras K, Feng W, Kratsios P.
The Iroquois (Iro/Irx) homeobox genes are conserved Hox targets involved in motor neuron development.
bioRxiv 2024   
[ PubMed ID = 38853975 ] [ RRC reference ]

Stefanakis N, Jiang J, Liang Y, Shaham S.
LET-381/FoxF and its target UNC-30/Pitx2 specify and maintain the molecular identity of C. elegans mesodermal glia that regulate motor behavior.
EMBO J 2024 43(6) 956-992 
[ PubMed ID = 38360995 ] [ RRC reference ]

Cole AG, Hashimshony T, Du Z, Yanai I.
Gene regulatory patterning codes in early cell fate specification of the C. elegans embryo.
Elife 2024 12  
[ PubMed ID = 38284404 ] [ RRC reference ]

Kudron M, Gevirtzman L, Victorsen A, Lear BC, Gao J, Xu J, Samanta S, Frink E, Tran-Pearson A, Huynh C, Vafeados D, Hammonds A, Fisher W, Wall M, Wesseling G, Hernandez V, Lin Z, Kasparian M, White K, Allada R, Gerstein M, Hillier L, Celniker SE, Reinke V, Waterston RH.
Binding profiles for 954 Drosophila and C. elegans transcription factors reveal tissue specific regulatory relationships.
bioRxiv 2024   
[ PubMed ID = 38293065 ] [ RRC reference ]

Medwig-Kinney TN, Kinney BA, Martinez MAQ, Yee C, Sirota SS, Mullarkey AA, Somineni N, Hippler J, Zhang W, Shen K, Hammell C, Pani AM, Matus DQ.
Dynamic compartmentalization of the pro-invasive transcription factor NHR-67 reveals a role for Groucho in regulating a proliferative-invasive cellular switch in C. elegans.
Elife 2023 12  
[ PubMed ID = 38038410 ] [ RRC reference ]

Kinney B, Sahu S, Stec N, Hills-Muckey K, Adams DW, Wang J, Jaremko M, Joshua-Tor L, Keil W, Hammell CM.
A circadian-like gene network programs the timing and dosage of heterochronic miRNA transcription during C. elegans development.
Dev Cell 2023 58(22) 2563-2579.e8 
[ PubMed ID = 37643611 ] [ RRC reference ]

Williams RTP, King DC, Mastroianni IR, Hill JL, Apenes NW, Ramirez G, Miner EC, Moore A, Coleman K, Nishimura EO.
Transcriptome profiling of the Caenorhabditis elegans intestine reveals that ELT-2 negatively and positively regulates intestinal gene expression within the context of a gene regulatory network.
Genetics 2023 224(4)  
[ PubMed ID = 37183501 ] [ RRC reference ]

Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A.
Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons.
PLoS Genet 2023 19(8) e1010885 
[ PubMed ID = 37603562 ] [ RRC reference ]

Brocal-Ruiz R, Esteve-Serrano A, Mora-Martínez C, Franco-Rivadeneira ML, Swoboda P, Tena JJ, Vilar M, Flames N.
Forkhead transcription factor FKH-8 cooperates with RFX in the direct regulation of sensory cilia in Caenorhabditis elegans.
Elife 2023 12  
[ PubMed ID = 37449480 ] [ RRC reference ]

Raj D, Kraish B, Martikainen J, Podraza-Farhanieh A, Kao G, Naredi P.
Cisplatin toxicity is counteracted by the activation of the p38/ATF-7 signaling pathway in post-mitotic C. elegans.
Nat Commun 2023 14(1) 2886 
[ PubMed ID = 37210583 ] [ RRC reference ]

Murray JI, Preston E, Crawford JP, Rumley JD, Amom P, Anderson BD, Sivaramakrishnan P, Patel SD, Bennett BA, Lavon TD, Hsiao E, Peng F, Zacharias AL.
The anterior Hox gene ceh-13 and elt-1/GATA activate the posterior Hox genes nob-1 and php-3 to specify posterior lineages in the C. elegans embryo.
PLoS Genet 2022 18(5) e1010187 
[ PubMed ID = 35500030 ] [ RRC reference ]

Jofré DM, Hoffman DK, Cervino AS, Hahn GM, Grundy M, Yun S, Amrit FRG, Stolz DB, Godoy LF, Salvatore E, Rossi FA, Ghazi A, Cirio MC, Yanowitz JL, Hochbaum D.
The CHARGE syndrome ortholog CHD-7 regulates TGF-β pathways in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2022 119(15) e2109508119 
[ PubMed ID = 35394881 ] [ RRC reference ]

Ding Q, Li R, Ren X, Chan LY, Ho VWS, Xie D, Ye P, Zhao Z.
Genomic architecture of 5S rDNA cluster and its variations within and between species.
BMC Genomics 2022 23(1) 238 
[ PubMed ID = 35346033 ] [ RRC reference ]

Vidal B, Gulez B, Cao WX, Leyva-Díaz E, Reilly MB, Tekieli T, Hobert O.
The enteric nervous system of the C. elegans pharynx is specified by the Sine oculis-like homeobox gene ceh-34.
Elife 2022 11  
[ PubMed ID = 35324425 ] [ RRC reference ]