分離済み変異体

tm4059

Allele Name

tm4059

Balance

Not Required

OutCross

Not Accepted

Sequence Name

H23L24.3a

Gene Name

ttll-11

Worm Base

Allele Name

tm4059

Gene Name

ttll-11

Sequence

H23L24.3a

Phenotype

homozygous viable

Mutation site

8296/8297-8803/8804 (507 bp deletion)

Chromosome

Putative gene structure

join(8220..8268, 8410..8537, 8583..8726, 8781..9033, 9095..9273, 9384..9536, 9585..9664, 9710..9779, 9836..9969, 10012..10112, 10163..10340, 10403..10469, 10515..10586)

Map position

3.94

Balancer

Map position of balancer

Sequence of primers

ExtFwd:ACCGCATCTCGTCGCTTTAC,IntFwd:TATCCGGATGGACGTTCAGA,ExtRev:CGCCTCTGTTTGATTGTCTG,IntRev:TGTGACTACTCACAGGCTAT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Lu YM, Yan S, Ti SC, Zheng C.
Editing of endogenous tubulins reveals varying effects of tubulin posttranslational modifications on axonal growth and regeneration.
Elife 2024 13
[ PubMed ID = 38949652 ] [ RRC reference ]

Power KM, Nguyen KC, Silva A, Singh S, Hall DH, Rongo C, Barr MM.
NEKL-4 regulates microtubule stability and mitochondrial health in C. elegans ciliated neurons.
bioRxiv 2024
[ PubMed ID = 38405845 ] [ RRC reference ]

Tran MV, Khuntsariya D, Fetter RD, Ferguson JW, Wang JT, Long AF, Cote LE, Wellard SR, Vázquez-Martínez N, Sallee MD, Genova M, Magiera MM, Eskinazi S, Lee JD, Peel N, Janke C, Stearns T, Shen K, Lansky Z, Magescas J, Feldman JL.
MAP9/MAPH-9 supports axonemal microtubule doublets and modulates motor movement.
Dev Cell 2024 59(2) 199-210.e11
[ PubMed ID = 38159567 ] [ RRC reference ]

Power KM, Akella JS, Gu A, Walsh JD, Bellotti S, Morash M, Zhang W, Ramadan YH, Ross N, Golden A, Smith HE, Barr MM, O'Hagan R.
Mutation of NEKL-4/NEK10 and TTLL genes suppress neuronal ciliary degeneration caused by loss of CCPP-1 deglutamylase function.
PLoS Genet 2020 16(10) e1009052
[ PubMed ID = 33064774 ] [ RRC reference ]

O'Hagan R, Silva M, Nguyen KCQ, Zhang W, Bellotti S, Ramadan YH, Hall DH, Barr MM.
Glutamylation Regulates Transport, Specializes Function, and Sculpts the Structure of Cilia.
Curr Biol 2017 27(22) 3430-3441.e6
[ PubMed ID = 29129530 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5
[ PubMed ID = 27661253 ] [ RRC reference ]

Chawla DG, Shah RV, Barth ZK, Lee JD, Badecker KE, Naik A, Brewster MM, Salmon TP, Peel N.
Caenorhabditis elegans glutamylating enzymes function redundantly in male mating.
Biol Open 2016 5(9) 1290-8
[ PubMed ID = 27635036 ] [ RRC reference ]