分離済み変異体

tm403

Allele Nametm403
BalanceNot Required
OutCrossNot Accepted
Sequence NameC09B8.7a
Gene Namepak-1
Worm BaseAllele Name tm403
Gene Name pak-1
Sequence C09B8.7a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Y. Jin: could not maintain as homozygote. Dr. M. Labouesse: Development 136, 3109 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 41185/41186-agcaacacatgcatc-42659/42660 (1474 bp deletion, 15 bp addition)
ChromosomeX
Putative gene structurecomplement(join(39132..39290, 39448..39519, 40132..40254, 40309..40382, 40433..41000, 41267..41359, 41404..41609, 41667..41814, 42363..42469, 42518..42836))
Map position-3.78
Balancer
Map position of balancer
Sequence of primersIntFwd:TTACTAGGGAATAGTGGCCA,ExtRev:TTCGTTTCAGCAGCTCGGCA,IntRev:CGAGGGAGAATCAGGTAATT,ExtFwd:GTTATGGGCAAAACTGGGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dai A, Ben Amar M.
Cyclic muscle contractions reinforce the actomyosin motors and mediate the full elongation of C. elegans embryo.
Elife 2024 12  
[ PubMed ID = 38900560 ] [ RRC reference ]

Fang C, Wei X, Shao X, Lin Y.
Force-mediated cellular anisotropy and plasticity dictate the elongation dynamics of embryos.
Sci Adv 2021 7(27)  
[ PubMed ID = 34193426 ] [ RRC reference ]

Suman SK, Daday C, Ferraro T, Vuong-Brender T, Tak S, Quintin S, Robin F, Gräter F, Labouesse M.
The plakin domain of C. elegans VAB-10/plectin acts as a hub in a mechanotransduction pathway to promote morphogenesis.
Development 2019 146(24)  
[ PubMed ID = 31784459 ] [ RRC reference ]

Lardennois A, Pásti G, Ferraro T, Llense F, Mahou P, Pontabry J, Rodriguez D, Kim S, Ono S, Beaurepaire E, Gally C, Labouesse M.
An actin-based viscoplastic lock ensures progressive body-axis elongation.
Nature 2019 573(7773) 266-270 
[ PubMed ID = 31462781 ] [ RRC reference ]

Nørgaard S, Deng S, Cao W, Pocock R.
Distinct CED-10/Rac1 domains confer context-specific functions in development.
PLoS Genet 2018 14(9) e1007670 
[ PubMed ID = 30265669 ] [ RRC reference ]

Peters EC, Gossett AJ, Goldstein B, Der CJ, Reiner DJ.
Redundant canonical and noncanonical Caenorhabditis elegans p21-activated kinase signaling governs distal tip cell migrations.
G3 (Bethesda) 2013 3(2) 181-95 
[ PubMed ID = 23390595 ] [ RRC reference ]

Goh KY, Ng NW, Hagen T, Inoue T.
p21-activated kinase interacts with Wnt signaling to regulate tissue polarity and gene expression.
Proc Natl Acad Sci U S A 2012 109(39) 15853-8 
[ PubMed ID = 23019370 ] [ RRC reference ]

Zhang H, Landmann F, Zahreddine H, Rodriguez D, Koch M, Labouesse M.
A tension-induced mechanotransduction pathway promotes epithelial morphogenesis.
Nature 2011 471(7336) 99-103 
[ PubMed ID = 21368832 ] [ RRC reference ]

Gally C, Wissler F, Zahreddine H, Quintin S, Landmann F, Labouesse M.
Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles.
Development 2009 136(18) 3109-19 
[ PubMed ID = 19675126 ] [ RRC reference ]