分離済み変異体

tm4024

Allele Nametm4024
Allele Type通常株
Sequence NameF33E2.2
Gene Namedlk-1
Worm BaseAllele Name tm4024
Gene Name dlk-1
Sequence F33E2.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 928/929-1388/1389 (460 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(AL022593.1:3863..3952, AL022593.1:4455..5110, AL022593.1:5919..6099, AL022593.1:6191..6351, 461..842, 971..1280, 1388..1537, 1634..2131, 2178..2317))
Map position13.62
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGAGCTCACTTTCCTTGAG,IntFwd:CTGTGAAGCAGCCTTGGAGT,ExtRev:CATTCCTCGGCGACGATCCT,IntRev:CCGACTGCATATTGATTCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sun Y, Zhou J, Debnath A, Xie B, Wang Z, Jin Y.
Multiple regulators constrain the abundance of Caenorhabditis elegans DLK-1 in ciliated sensory neurons.
G3 (Bethesda) 2025 15(3)  
[ PubMed ID = 39854273 ] [ RRC reference ]

Kumar S, Behera S, Basu A, Dey S, Ghosh-Roy A.
Swimming Exercise Promotes Post-injury Axon Regeneration and Functional Restoration through AMPK.
eNeuro 2021 8(3)  
[ PubMed ID = 34031101 ] [ RRC reference ]

Kulkarni SS, Sabharwal V, Sheoran S, Basu A, Matsumoto K, Hisamoto N, Ghosh-Roy A, Koushika SP.
UNC-16 alters DLK-1 localization and negatively regulates actin and microtubule dynamics in Caenorhabditis elegans regenerating neurons.
Genetics 2021 219(3)  
[ PubMed ID = 34740241 ] [ RRC reference ]

Brar HK, Dey S, Bhardwaj S, Pande D, Singh P, Dey S, Ghosh-Roy A.
Dendrite regeneration in C. elegans is controlled by the RAC GTPase CED-10 and the RhoGEF TIAM-1.
PLoS Genet 2022 18(3) e1010127 
[ PubMed ID = 35344539 ] [ RRC reference ]

Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M.
Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons.
PLoS Genet 2020 16(9) e1008704 
[ PubMed ID = 32986702 ] [ RRC reference ]

van der Vaart A, Rademakers S, Jansen G.
DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.
PLoS Genet 2015 11(12) e1005733 
[ PubMed ID = 26657059 ] [ RRC reference ]

D'Souza SA, Rajendran L, Bagg R, Barbier L, van Pel DM, Moshiri H, Roy PJ.
The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans.
PLoS Genet 2016 12(4) e1006010 
[ PubMed ID = 27123983 ] [ RRC reference ]

Basu A, Dey S, Puri D, Das Saha N, Sabharwal V, Thyagarajan P, Srivastava P, Koushika SP, Ghosh-Roy A.
let-7 miRNA controls CED-7 homotypic adhesion and EFF-1-mediated axonal self-fusion to restore touch sensation following injury.
Proc Natl Acad Sci U S A 2017 114(47) E10206-E10215 
[ PubMed ID = 29109254 ] [ RRC reference ]

Wang S, Tang NH, Lara-Gonzalez P, Zhao Z, Cheerambathur DK, Prevo B, Chisholm AD, Desai A, Oegema K.
A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans.
Development 2017 144(14) 2694-2701 
[ PubMed ID = 28619826 ] [ RRC reference ]

Yan D, Jin Y.
Regulation of DLK-1 kinase activity by calcium-mediated dissociation from an inhibitory isoform.
Neuron 2012 76(3) 534-48 
[ PubMed ID = 23141066 ] [ RRC reference ]

Blum ES, Abraham MC, Yoshimura S, Lu Y, Shaham S.
Control of nonapoptotic developmental cell death in Caenorhabditis elegans by a polyglutamine-repeat protein.
Science 2012 335(6071) 970-3 
[ PubMed ID = 22363008 ] [ RRC reference ]

Hubert T, Wu Z, Chisholm AD, Jin Y.
S6 kinase inhibits intrinsic axon regeneration capacity via AMP kinase in Caenorhabditis elegans.
J Neurosci 2014 34(3) 758-63 
[ PubMed ID = 24431434 ] [ RRC reference ]

Noma K, Goncharov A, Jin Y.
Systematic analyses of rpm-1 suppressors reveal roles for ESS-2 in mRNA splicing in Caenorhabditis elegans.
Genetics 2014 198(3) 1101-15 
[ PubMed ID = 25194163 ] [ RRC reference ]

Kurup N, Yan D, Goncharov A, Jin Y.
Dynamic microtubules drive circuit rewiring in the absence of neurite remodeling.
Curr Biol 2015 25(12) 1594-605 
[ PubMed ID = 26051896 ] [ RRC reference ]

Giles AC, Opperman KJ, Rankin CH, Grill B.
Developmental Function of the PHR Protein RPM-1 Is Required for Learning in Caenorhabditis elegans.
G3 (Bethesda) 2015 5(12) 2745-57 
[ PubMed ID = 26464359 ] [ RRC reference ]

Chen F, Zhou Y, Qi YB, Khivansara V, Li H, Chun SY, Kim JK, Fu XD, Jin Y.
Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development.
Genes Dev 2015 29(22) 2377-90 
[ PubMed ID = 26588990 ] [ RRC reference ]