| Allele Name | tm4006 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F32B6.10 |
| Gene Name | F32B6.10 |
| Worm Base | Allele Name |
tm4006
|
| Gene Name |
F32B6.10
|
| Sequence |
F32B6.10
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 10502/10503-TTCTCAAGTNGNACCAAGAAG-11288/11289 (786 bp deletion + 21 bp insertion) |
| Chromosome | IV |
| Putative gene structure | complement(join(8524..8889, 8937..9077, 9122..9231, 9783..9993, 10241..10396, 10440..10543, 10592..10818, 10971..11206, 11322..11393)) |
| Map position | 4.44 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:AACCCGTGGTTGTCCACGTT,ExtFwd:TGGTCTTTGCAAGGCTCTAC,ExtRev:CATAACCTCAGCACAGCCCA,IntFwd:AGGCTCTACACTCAAGCAGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Kurup N, Yan D, Kono K, Jin Y.
Differential regulation of polarized synaptic vesicle trafficking and synapse stability in neural circuit rewiring in Caenorhabditis elegans.
PLoS Genet 2017 13(6) e1006844
[ PubMed ID = 28636662 ]
[ RRC reference ]
|
Neal SJ, Park J, DiTirro D, Yoon J, Shibuya M, Choi W, Schroeder FC, Butcher RA, Kim K, Sengupta P.
A Forward Genetic Screen for Molecules Involved in Pheromone-Induced Dauer Formation in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(5) 1475-87
[ PubMed ID = 26976437 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.