| Allele Name | tm399 |
| Allele Type | 通常株 |
| Sequence Name | C12D8.10 |
| Gene Name | akt-1 |
| Worm Base | Allele Name |
tm399
|
| Gene Name |
akt-1
|
| Sequence |
C12D8.10
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. K. Ashrafi: substantially increased fat (nile red staining) and slight developmental delay. Dr. T. Schedl: fertile, normal locomotion. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 30815/30816-31165/31166(350 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(30791..30894, 31690..31798, 31873..32061, 32107..32268, 32314..32511, 32676..32867, 33512..33640, 33688..34050, 34107..34286) |
| Map position | 2.42 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CCAGCCATGATAAGTTCGAA,ExtRev:CTTGCTTGGGAACCTTAGAT,IntFwd:CGGTGAAAGAATGTCGATGA,ExtFwd:TTTACGACGGCGCCGGTGAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Nawa M, Kage-Nakadai E, Aiso S, Okamoto K, Mitani S, Matsuoka M.
Reduced expression of BTBD10, an Akt activator, leads to motor neuron death.
Cell Death Differ 2012 19(8) 1398-407
[ PubMed ID = 22388351 ]
[ RRC reference ]
|
Christensen R, de la Torre-Ubieta L, Bonni A, Colón-Ramos DA.
A conserved PTEN/FOXO pathway regulates neuronal morphology during C. elegans development.
Development 2011 138(23) 5257-67
[ PubMed ID = 22069193 ]
[ RRC reference ]
|
Nakagawa A, Sullivan KD, Xue D.
Caspase-activated phosphoinositide binding by CNT-1 promotes apoptosis by inhibiting the AKT pathway.
Nat Struct Mol Biol 2014 21(12) 1082-90
[ PubMed ID = 25383666 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.