| Allele Name | tm3968 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C44E4.1 |
| Gene Name | C44E4.1 |
| Worm Base | Allele Name |
tm3968
|
| Gene Name |
C44E4.1
|
| Sequence |
C44E4.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 7245/7246-TATATACA-7940/7941 (695 bp deletion + 8 bp insertion) |
| Chromosome | I |
| Putative gene structure | complement(join(4658..4846, 4897..5203, 5661..6103, 6416..7406, 7669..8063, 8286..8420, 8462..9141, 9192..9667, 10227..10531, 11193..12389, 12919..13325, 14065..15635, 16257..17163, 17233..17362)) |
| Map position | -1.04 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TTTCGCCATATCCTGGGTCT,IntFwd:GCTCGTGTCGATTTAGGGAC,ExtRev:AGTCGAGCGATCCTGGAATG,IntRev:GGCCATTGATGCGTGATATC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
McDiarmid TA, Belmadani M, Liang J, Meili F, Mathews EA, Mullen GP, Hendi A, Wong WR, Rand JB, Mizumoto K, Haas K, Pavlidis P, Rankin CH. Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation. Proc Natl Acad Sci U S A 2020 117(1) 656-667
[ PubMed ID = 31754030 ]
[ RRC reference ]
|
Rinschen MM, Bharill P, Wu X, Kohli P, Reinert MJ, Kretz O, Saez I, Schermer B, Höhne M, Bartram MP, Aravamudhan S, Brooks BR, Vilchez D, Huber TB, Müller RU, Krüger M, Benzing T. The ubiquitin ligase Ubr4 controls stability of podocin/MEC-2 supercomplexes. Hum Mol Genet 2016 25(7) 1328-44
[ PubMed ID = 26792178 ]
[ RRC reference ]
|
|