分離済み変異体

tm3951

Allele Nametm3951
BalanceCompleted
OutCrossNot Accepted
Sequence NameF10E9.8
Gene Namesas-4
Worm BaseAllele Name tm3951 (x1)
Gene Name sas-4
Sequence F10E9.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 38543/38544-39148/39149 (575 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(35732..36020, 36774..36833, 36882..37069, 37116..37274, 37545..37988, 38165..38697, 38740..38959, 39076..39420, 39501..39596, 39645..39737))
Map position-0.33
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtFwd:CTAAAGTCTGTAGAGTGCTC,IntFwd:CTTTAGCCGGTTTCCGTCTT,ExtRev:GCCTTCAGATGGCTTCCGAT,IntRev:TATCGGTGCCGACGGTGAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Serwas D, Su TY, Roessler M, Wang S, Dammermann A.
Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans.
J Cell Biol 2017 216(6) 1659-1671 
[ PubMed ID = 28411189 ] [ RRC reference ]

Cabral G, Sans SS, Cowan CR, Dammermann A.
Multiple mechanisms contribute to centriole separation in C. elegans.
Curr Biol 2013 23(14) 1380-7 
[ PubMed ID = 23885867 ] [ RRC reference ]

Mikeladze-Dvali T, von Tobel L, Strnad P, Knott G, Leonhardt H, Schermelleh L, Gönczy P.
Analysis of centriole elimination during C. elegans oogenesis.
Development 2012 139(9) 1670-9 
[ PubMed ID = 22492357 ] [ RRC reference ]

Kitagawa D, Flückiger I, Polanowska J, Keller D, Reboul J, Gönczy P.
PP2A phosphatase acts upon SAS-5 to ensure centriole formation in C. elegans embryos.
Dev Cell 2011 20(4) 550-62 
[ PubMed ID = 21497765 ] [ RRC reference ]