分離済み変異体

tm395

Allele Nametm395
BalanceNot Required
OutCrossNot Accepted
Sequence NameK08E3.7
Gene Namepdr-1
Worm BaseAllele Name tm395 (x1)
Gene Name pdr-1
Sequence K08E3.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable, Dr. C. Rongo: normal GLR-1::GFP expression. Dr. R. Baumeister: Hum. Mol. Genetics 14, 3407 (2005).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31601/31602-32081/32082 (480 bp deletion)
ChromosomeIII
Putative gene structurejoin(30814..30882, 30928..31073, 31164..31600, 32013..32217, 32271..32345, 32392..32533)
Map position23.73
Balancerunc-25 (e156) III
Map position of balancer
Sequence of primersIntFwd:TTGTCTCACACGCGACGCGA,ExtRev:GGTACAGTGAATGTGAGCAC,IntRev:CGGTTGCCACGTGGCATTTT,ExtFwd:AATTTGAAGCTCGCTGCGTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Knowlton WM, Hubert T, Wu Z, Chisholm AD, Jin Y.
A Select Subset of Electron Transport Chain Genes Associated with Optic Atrophy Link Mitochondria to Axon Regeneration in Caenorhabditis elegans.
Front Neurosci 2017 11 263 
[ PubMed ID = 28539870 ] [ RRC reference ]

Schiavi A, Maglioni S, Palikaras K, Shaik A, Strappazzon F, Brinkmann V, Torgovnick A, Castelein N, De Henau S, Braeckman BP, Cecconi F, Tavernarakis N, Ventura N.
Iron-Starvation-Induced Mitophagy Mediates Lifespan Extension upon Mitochondrial Stress in C. elegans.
Curr Biol 2015 25(14) 1810-22 
[ PubMed ID = 26144971 ] [ RRC reference ]

Cabello J, Sämann J, Gómez-Orte E, Erazo T, Coppa A, Pujol A, Büssing I, Schulze B, Lizcano JM, Ferrer I, Baumeister R, Dalfo E.
PDR-1/hParkin negatively regulates the phagocytosis of apoptotic cell corpses in Caenorhabditis elegans.
Cell Death Dis 2014 5(3) e1120 
[ PubMed ID = 24625979 ] [ RRC reference ]

Song MH, Liu Y, Anderson DE, Jahng WJ, O'Connell KF.
Protein phosphatase 2A-SUR-6/B55 regulates centriole duplication in C. elegans by controlling the levels of centriole assembly factors.
Dev Cell 2011 20(4) 563-71 
[ PubMed ID = 21497766 ] [ RRC reference ]

Kramer LB, Shim J, Previtera ML, Isack NR, Lee MC, Firestein BL, Rongo C.
UEV-1 is an ubiquitin-conjugating enzyme variant that regulates glutamate receptor trafficking in C. elegans neurons.
PLoS One 2010 5(12) e14291 
[ PubMed ID = 21179194 ] [ RRC reference ]

Nyamsuren O, Faggionato D, Loch W, Schulze E, Baumeister R.
A mutation in CHN-1/CHIP suppresses muscle degeneration in Caenorhabditis elegans.
Dev Biol 2007 312(1) 193-202 
[ PubMed ID = 17961535 ] [ RRC reference ]

Springer W, Hoppe T, Schmidt E, Baumeister R.
A Caenorhabditis elegans Parkin mutant with altered solubility couples alpha-synuclein aggregation to proteotoxic stress.
Hum Mol Genet 2005 14(22) 3407-23 
[ PubMed ID = 16204351 ] [ RRC reference ]